ID: 948687466

View in Genome Browser
Species Human (GRCh38)
Location 2:239677945-239677967
Sequence TCTCCTGGCCTGGGTACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948687458_948687466 1 Left 948687458 2:239677921-239677943 CCTAGAGCCCACTCTCTCCTCCT No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data
948687454_948687466 16 Left 948687454 2:239677906-239677928 CCTCAGGCCTTGGCCCCTAGAGC No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data
948687452_948687466 28 Left 948687452 2:239677894-239677916 CCTGGTGGATTTCCTCAGGCCTT No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data
948687455_948687466 9 Left 948687455 2:239677913-239677935 CCTTGGCCCCTAGAGCCCACTCT No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data
948687456_948687466 3 Left 948687456 2:239677919-239677941 CCCCTAGAGCCCACTCTCTCCTC No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data
948687459_948687466 -6 Left 948687459 2:239677928-239677950 CCCACTCTCTCCTCCTTTCTCCT No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data
948687457_948687466 2 Left 948687457 2:239677920-239677942 CCCTAGAGCCCACTCTCTCCTCC No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data
948687460_948687466 -7 Left 948687460 2:239677929-239677951 CCACTCTCTCCTCCTTTCTCCTG No data
Right 948687466 2:239677945-239677967 TCTCCTGGCCTGGGTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948687466 Original CRISPR TCTCCTGGCCTGGGTACCTG AGG Intergenic
No off target data available for this crispr