ID: 948689603

View in Genome Browser
Species Human (GRCh38)
Location 2:239693740-239693762
Sequence AATATTAGGGAGAAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948689603_948689609 -10 Left 948689603 2:239693740-239693762 CCCTCCATCTTCTCCCTAATATT No data
Right 948689609 2:239693753-239693775 CCCTAATATTTGTGGCAAATGGG No data
948689603_948689614 27 Left 948689603 2:239693740-239693762 CCCTCCATCTTCTCCCTAATATT No data
Right 948689614 2:239693790-239693812 CTTCACCCCCTCCACAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948689603 Original CRISPR AATATTAGGGAGAAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr