ID: 948691283

View in Genome Browser
Species Human (GRCh38)
Location 2:239706691-239706713
Sequence GAGGGCACTCTGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948691277_948691283 -5 Left 948691277 2:239706673-239706695 CCAGGTCAGAGGGAGCCAGAGGG No data
Right 948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG No data
948691270_948691283 23 Left 948691270 2:239706645-239706667 CCTACATGAAAAACTCAGAGCTG No data
Right 948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948691283 Original CRISPR GAGGGCACTCTGGAGGAGGA AGG Intergenic
No off target data available for this crispr