ID: 948692101

View in Genome Browser
Species Human (GRCh38)
Location 2:239712466-239712488
Sequence GACCCACTCATGGTTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948692101_948692106 23 Left 948692101 2:239712466-239712488 CCAGAGGCAACCATGAGTGGGTC No data
Right 948692106 2:239712512-239712534 AACAAATGCCCAGAACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948692101 Original CRISPR GACCCACTCATGGTTGCCTC TGG (reversed) Intergenic
No off target data available for this crispr