ID: 948693532

View in Genome Browser
Species Human (GRCh38)
Location 2:239721386-239721408
Sequence CTTTATGTGGAGACAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948693523_948693532 19 Left 948693523 2:239721344-239721366 CCTCGGCCCATGTGGGGATGGTG No data
Right 948693532 2:239721386-239721408 CTTTATGTGGAGACAAGGAAAGG No data
948693524_948693532 13 Left 948693524 2:239721350-239721372 CCCATGTGGGGATGGTGTCATTT No data
Right 948693532 2:239721386-239721408 CTTTATGTGGAGACAAGGAAAGG No data
948693525_948693532 12 Left 948693525 2:239721351-239721373 CCATGTGGGGATGGTGTCATTTC No data
Right 948693532 2:239721386-239721408 CTTTATGTGGAGACAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948693532 Original CRISPR CTTTATGTGGAGACAAGGAA AGG Intergenic
No off target data available for this crispr