ID: 948693930

View in Genome Browser
Species Human (GRCh38)
Location 2:239723256-239723278
Sequence CAGTTCTAGGACAGAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948693930_948693935 5 Left 948693930 2:239723256-239723278 CCTCCTGCTCTGTCCTAGAACTG No data
Right 948693935 2:239723284-239723306 CAGGGATGCGTTTGCCTTGCAGG No data
948693930_948693937 15 Left 948693930 2:239723256-239723278 CCTCCTGCTCTGTCCTAGAACTG No data
Right 948693937 2:239723294-239723316 TTTGCCTTGCAGGTCCCACTGGG No data
948693930_948693936 14 Left 948693930 2:239723256-239723278 CCTCCTGCTCTGTCCTAGAACTG No data
Right 948693936 2:239723293-239723315 GTTTGCCTTGCAGGTCCCACTGG No data
948693930_948693938 16 Left 948693930 2:239723256-239723278 CCTCCTGCTCTGTCCTAGAACTG No data
Right 948693938 2:239723295-239723317 TTGCCTTGCAGGTCCCACTGGGG No data
948693930_948693939 17 Left 948693930 2:239723256-239723278 CCTCCTGCTCTGTCCTAGAACTG No data
Right 948693939 2:239723296-239723318 TGCCTTGCAGGTCCCACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948693930 Original CRISPR CAGTTCTAGGACAGAGCAGG AGG (reversed) Intergenic
No off target data available for this crispr