ID: 948694307

View in Genome Browser
Species Human (GRCh38)
Location 2:239725520-239725542
Sequence CTGAAGCTGCACCAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948694307_948694318 6 Left 948694307 2:239725520-239725542 CCTCCACCCTGGTGCAGCTTCAG No data
Right 948694318 2:239725549-239725571 GAAGGTGAGTGAGGGAGGAGTGG No data
948694307_948694315 -3 Left 948694307 2:239725520-239725542 CCTCCACCCTGGTGCAGCTTCAG No data
Right 948694315 2:239725540-239725562 CAGGAGGGAGAAGGTGAGTGAGG No data
948694307_948694319 18 Left 948694307 2:239725520-239725542 CCTCCACCCTGGTGCAGCTTCAG No data
Right 948694319 2:239725561-239725583 GGGAGGAGTGGCGTCCATGCTGG No data
948694307_948694316 -2 Left 948694307 2:239725520-239725542 CCTCCACCCTGGTGCAGCTTCAG No data
Right 948694316 2:239725541-239725563 AGGAGGGAGAAGGTGAGTGAGGG No data
948694307_948694317 1 Left 948694307 2:239725520-239725542 CCTCCACCCTGGTGCAGCTTCAG No data
Right 948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG No data
948694307_948694320 30 Left 948694307 2:239725520-239725542 CCTCCACCCTGGTGCAGCTTCAG No data
Right 948694320 2:239725573-239725595 GTCCATGCTGGCCAGAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948694307 Original CRISPR CTGAAGCTGCACCAGGGTGG AGG (reversed) Intergenic