ID: 948697716

View in Genome Browser
Species Human (GRCh38)
Location 2:239741680-239741702
Sequence CCATCCACACACATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948697710_948697716 10 Left 948697710 2:239741647-239741669 CCACAGACAGAGCACCAAGGTGC No data
Right 948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG No data
948697712_948697716 -4 Left 948697712 2:239741661-239741683 CCAAGGTGCAGCTGGAGATCCAT No data
Right 948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG No data
948697709_948697716 11 Left 948697709 2:239741646-239741668 CCCACAGACAGAGCACCAAGGTG No data
Right 948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948697716 Original CRISPR CCATCCACACACATGGAGCT GGG Intergenic
No off target data available for this crispr