ID: 948699965

View in Genome Browser
Species Human (GRCh38)
Location 2:239753331-239753353
Sequence CTGTCCCCACTGGCCAGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948699965_948699975 18 Left 948699965 2:239753331-239753353 CCGTGTCTGGCCAGTGGGGACAG No data
Right 948699975 2:239753372-239753394 CTGCTCCATTCCGCCCTCCATGG No data
948699965_948699979 30 Left 948699965 2:239753331-239753353 CCGTGTCTGGCCAGTGGGGACAG No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699965_948699978 29 Left 948699965 2:239753331-239753353 CCGTGTCTGGCCAGTGGGGACAG No data
Right 948699978 2:239753383-239753405 CGCCCTCCATGGCATCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948699965 Original CRISPR CTGTCCCCACTGGCCAGACA CGG (reversed) Intergenic