ID: 948699975

View in Genome Browser
Species Human (GRCh38)
Location 2:239753372-239753394
Sequence CTGCTCCATTCCGCCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948699965_948699975 18 Left 948699965 2:239753331-239753353 CCGTGTCTGGCCAGTGGGGACAG No data
Right 948699975 2:239753372-239753394 CTGCTCCATTCCGCCCTCCATGG No data
948699968_948699975 -8 Left 948699968 2:239753357-239753379 CCCACCCCTTCCCTGCTGCTCCA No data
Right 948699975 2:239753372-239753394 CTGCTCCATTCCGCCCTCCATGG No data
948699967_948699975 8 Left 948699967 2:239753341-239753363 CCAGTGGGGACAGCGGCCCACCC No data
Right 948699975 2:239753372-239753394 CTGCTCCATTCCGCCCTCCATGG No data
948699969_948699975 -9 Left 948699969 2:239753358-239753380 CCACCCCTTCCCTGCTGCTCCAT No data
Right 948699975 2:239753372-239753394 CTGCTCCATTCCGCCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948699975 Original CRISPR CTGCTCCATTCCGCCCTCCA TGG Intergenic