ID: 948699979

View in Genome Browser
Species Human (GRCh38)
Location 2:239753384-239753406
Sequence GCCCTCCATGGCATCAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948699973_948699979 -6 Left 948699973 2:239753367-239753389 CCCTGCTGCTCCATTCCGCCCTC No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699969_948699979 3 Left 948699969 2:239753358-239753380 CCACCCCTTCCCTGCTGCTCCAT No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699970_948699979 0 Left 948699970 2:239753361-239753383 CCCCTTCCCTGCTGCTCCATTCC No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699967_948699979 20 Left 948699967 2:239753341-239753363 CCAGTGGGGACAGCGGCCCACCC No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699965_948699979 30 Left 948699965 2:239753331-239753353 CCGTGTCTGGCCAGTGGGGACAG No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699971_948699979 -1 Left 948699971 2:239753362-239753384 CCCTTCCCTGCTGCTCCATTCCG No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699972_948699979 -2 Left 948699972 2:239753363-239753385 CCTTCCCTGCTGCTCCATTCCGC No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699974_948699979 -7 Left 948699974 2:239753368-239753390 CCTGCTGCTCCATTCCGCCCTCC No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data
948699968_948699979 4 Left 948699968 2:239753357-239753379 CCCACCCCTTCCCTGCTGCTCCA No data
Right 948699979 2:239753384-239753406 GCCCTCCATGGCATCAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948699979 Original CRISPR GCCCTCCATGGCATCAATCT GGG Intergenic