ID: 948700497

View in Genome Browser
Species Human (GRCh38)
Location 2:239756753-239756775
Sequence CAGTCTTATTTCAGAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948700496_948700497 11 Left 948700496 2:239756719-239756741 CCTGGGCATTGCTGGAGTGAGGT 0: 1
1: 0
2: 1
3: 15
4: 176
Right 948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG 0: 1
1: 0
2: 1
3: 26
4: 203
948700491_948700497 26 Left 948700491 2:239756704-239756726 CCCAAAGCCTGGACTCCTGGGCA 0: 1
1: 0
2: 0
3: 78
4: 272
Right 948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG 0: 1
1: 0
2: 1
3: 26
4: 203
948700490_948700497 27 Left 948700490 2:239756703-239756725 CCCCAAAGCCTGGACTCCTGGGC 0: 1
1: 0
2: 0
3: 32
4: 326
Right 948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG 0: 1
1: 0
2: 1
3: 26
4: 203
948700493_948700497 19 Left 948700493 2:239756711-239756733 CCTGGACTCCTGGGCATTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 297
Right 948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG 0: 1
1: 0
2: 1
3: 26
4: 203
948700488_948700497 28 Left 948700488 2:239756702-239756724 CCCCCAAAGCCTGGACTCCTGGG 0: 1
1: 0
2: 1
3: 28
4: 317
Right 948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG 0: 1
1: 0
2: 1
3: 26
4: 203
948700492_948700497 25 Left 948700492 2:239756705-239756727 CCAAAGCCTGGACTCCTGGGCAT 0: 1
1: 0
2: 1
3: 32
4: 252
Right 948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG 0: 1
1: 0
2: 1
3: 26
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948700497 Original CRISPR CAGTCTTATTTCAGAGACAC TGG Intergenic
901466539 1:9425309-9425331 CAGTCATATTTCAGGGGCAGTGG + Intergenic
902379662 1:16046738-16046760 CAGCCTCATTTCACAGACAAAGG + Intronic
902979247 1:20111246-20111268 AAGTCTTCTCTCAGTGACACTGG - Intergenic
903044641 1:20555507-20555529 CAGTTTTCTTTCAGAGGCTCTGG + Intergenic
905291383 1:36924066-36924088 CAGACACATTTCAGAGACAGCGG + Intronic
906924290 1:50098106-50098128 CATTCTTATTTCACTGACAATGG + Intronic
911273481 1:95831838-95831860 CAGTCTCCTTGCAGAGACATGGG + Intergenic
912793240 1:112674277-112674299 CACCTTTATCTCAGAGACACTGG + Intronic
918385612 1:184004745-184004767 CAGTCTCACTACAGAGCCACAGG + Intronic
918839377 1:189514284-189514306 CTGTCTTATTTCAGTAAAACGGG - Intergenic
920198694 1:204245953-204245975 CAGTCTTGGTTCAGAAACTCGGG - Intronic
920363852 1:205437768-205437790 ATGTCTTATTTCTGAGACTCAGG - Intronic
921842731 1:219845651-219845673 CAGTTTTATTTTATAGACAAGGG - Intronic
921859205 1:220023526-220023548 AAGTGATATTTCAGAGATACAGG + Intronic
922883947 1:229003710-229003732 TTGTCTTATTACAGACACACAGG - Intergenic
923320643 1:232829703-232829725 GACTTTTATTTCAGAGACATAGG + Intergenic
924134130 1:240945610-240945632 AAGTCTAATTTCAAAGCCACAGG + Intronic
1063856773 10:10263967-10263989 CAGTCTGAATTCAGGGACAAAGG - Intergenic
1065460092 10:25951952-25951974 CAAACATATTTCAGAGTCACAGG - Intronic
1065976079 10:30843352-30843374 AAGTCGTATTTTAGAAACACTGG - Intronic
1071062538 10:81589945-81589967 CTGTCTTATTTCAGAAAGACAGG - Intergenic
1073549903 10:104389035-104389057 AAGTGGTATGTCAGAGACACAGG - Intronic
1075281957 10:121146760-121146782 CTGTCTTATTTCAGAAAGATAGG + Intergenic
1075779770 10:125009647-125009669 CAGTGTTATTTCAGAGGCTTGGG + Intronic
1077830686 11:5866771-5866793 AACTCTTATTTCAGATACAGGGG - Intronic
1079888555 11:26020475-26020497 CAGTCTTATTTCATAGAGAATGG - Intergenic
1080068953 11:28055642-28055664 CAGTCCTATTTCAGAGACTGAGG - Intronic
1081052607 11:38363664-38363686 AAGTCTTGTTTTAGAGACAGAGG + Intergenic
1081233942 11:40622472-40622494 CAGTCTTCTTTCATAGCCAAGGG - Intronic
1081522520 11:43896941-43896963 CATTTTTTTTTTAGAGACACAGG + Intronic
1081572622 11:44301171-44301193 ATGTCTTATTTCACAGACAAAGG - Intronic
1082072691 11:47951656-47951678 CACTCTTGTTTGAGAAACACTGG + Intergenic
1085116314 11:73935324-73935346 CAGTGTGGTTTCAGAGACCCAGG + Intergenic
1089981872 11:122779457-122779479 CAGTCTTCACTCAGAGACAAGGG - Intronic
1091129515 11:133133708-133133730 CAGTCTGGTGTAAGAGACACAGG - Intronic
1091332658 11:134742543-134742565 CAGTCTCATCTCAGAGGCACTGG + Intergenic
1092787121 12:12037014-12037036 CAGTGTTATTTCAGAGGCTCAGG + Intergenic
1093243287 12:16704606-16704628 CAGGCTTATTTTAGAAAAACTGG + Intergenic
1095492001 12:42744677-42744699 CAGCCTTCTTTTAAAGACACAGG + Intergenic
1096454083 12:51770766-51770788 CAATCTGTTTTCAGAGCCACTGG - Intronic
1099318709 12:81117918-81117940 CAGACTTCTTTCAAACACACTGG - Intronic
1100168506 12:91945838-91945860 AAGTCTCATTTCAGAGACAATGG + Intergenic
1101666891 12:106825185-106825207 CAGTGGTATTAAAGAGACACAGG - Intronic
1102316772 12:111894568-111894590 CAGACATATTACAGAGAAACAGG - Intronic
1102437540 12:112937052-112937074 CAGTCTTCTTCCTGAGTCACAGG - Intergenic
1102690759 12:114758839-114758861 CAGTTTTATTTGACAAACACTGG - Intergenic
1103889100 12:124225145-124225167 AAATTATATTTCAGAGACACTGG + Intronic
1105475195 13:20722553-20722575 CAGGCTGAATTCAGAGACCCAGG - Exonic
1106548645 13:30752405-30752427 CAGTGTTAGTTCAGATACAAGGG + Intronic
1106911219 13:34465445-34465467 CCTTCTTATCTCAGAGAGACAGG - Intergenic
1107088467 13:36450481-36450503 CAATTTCATTTCAGAAACACTGG - Intergenic
1108090278 13:46842413-46842435 ATGTCTCATTTCAGAGACTCTGG + Intronic
1109570250 13:64179212-64179234 CAGTCTTATTTTGAAGAGACAGG + Intergenic
1111552776 13:89837422-89837444 CACTCTTATTCTAGAAACACTGG - Intergenic
1111767940 13:92558593-92558615 TATTCTGATTTCAGAGACATTGG - Intronic
1113357874 13:109600655-109600677 CAGTATTTTGTCAGAGACAAGGG + Intergenic
1114735285 14:25037244-25037266 CTGTCCTATTTCAGAGTCCCAGG - Intronic
1116580505 14:46635399-46635421 CATTCTTATTTCAGACAAAGCGG - Intergenic
1116763373 14:49041522-49041544 TAGTCTCATTTCAGAGAGAAAGG + Intergenic
1117013370 14:51493276-51493298 CAATTTTATTTCATAGACACAGG + Intronic
1117516861 14:56510523-56510545 CAGTCATAGTTAAGAGACACTGG + Intronic
1117660357 14:57997785-57997807 CAATTTCATATCAGAGACACTGG - Intergenic
1118127915 14:62929561-62929583 CACTCTTATCTCAGACACTCTGG + Intronic
1119578947 14:75756915-75756937 CAGTCTTAGTTTAGAGACAATGG + Intronic
1123968884 15:25486107-25486129 CAGTTATATTTCAGAGACTTTGG + Intergenic
1126157241 15:45576968-45576990 CAGTCTTCACTCAGAGACCCAGG - Intergenic
1126391618 15:48161596-48161618 CAGTAATATTTCAGAGACCCTGG - Intronic
1126456282 15:48865656-48865678 CAATCTTATTTCCTATACACAGG + Intronic
1126954388 15:53916036-53916058 CAGTTTTATTTCAAAAATACAGG - Intergenic
1127188555 15:56506103-56506125 CAGTTCTATTGCAGAGACAGTGG - Intergenic
1130200271 15:81819596-81819618 AAGTCTTTCTTCAGAGTCACTGG - Intergenic
1135466455 16:22690484-22690506 TAGTCTTGTCTCGGAGACACTGG - Intergenic
1137048156 16:35687216-35687238 CAGTCTAATTATAGAGACACTGG - Intergenic
1137479779 16:48842639-48842661 CAGTCTTCTTTCCCAGAGACAGG + Intergenic
1140131812 16:72168704-72168726 CAGCCTTATATAAGAGAAACCGG - Intronic
1142626758 17:1197209-1197231 CACTCCTATTTCAGAGCCTCTGG + Intronic
1143807961 17:9445423-9445445 CATTCTTCTTTCTGAGACCCTGG - Intronic
1144134704 17:12282130-12282152 CAGTATTATTTAAGGGATACTGG + Intergenic
1144311355 17:14016957-14016979 CAGTATGATATCAGAGGCACTGG - Intergenic
1144541761 17:16149577-16149599 CACTTTTTTTCCAGAGACACTGG + Intronic
1146607060 17:34269962-34269984 GTGTCTCATTTCAGAGAAACTGG + Intergenic
1156650216 18:39216865-39216887 CTGTGTGATTTCAGGGACACTGG + Intergenic
1157114562 18:44850973-44850995 CAGTCTCCTATCAAAGACACAGG + Intronic
1157736066 18:50050692-50050714 TTGTCTTATTTCAGAATCACAGG - Intronic
1157844811 18:50993374-50993396 CACTTTTATTTCAGAGACTAGGG - Intronic
1164370087 19:27636410-27636432 CATTCTAATGTGAGAGACACCGG - Intergenic
1164373293 19:27660125-27660147 CAGTCTAATGATAGAGACACTGG - Intergenic
1164379557 19:27720242-27720264 CAGCCTAATTACAGAAACACCGG - Intergenic
1164384032 19:27758420-27758442 CAGTCTAATGATAGAGACACTGG - Intergenic
1164758489 19:30708809-30708831 CAGTCTTGTTCCTGAGAAACAGG - Intronic
1167089312 19:47332463-47332485 CAGTCTTATTACAGCCACACTGG + Intronic
925547255 2:5030288-5030310 CACTCTTATTTCAGATTCAGGGG + Intergenic
925819353 2:7784668-7784690 CAGTTCTTTTTCATAGACACCGG - Intergenic
928509739 2:31991809-31991831 CAATCTGATTTCTAAGACACAGG + Intronic
929961794 2:46502703-46502725 CAGGCTTATTTCACTGATACCGG - Intronic
930205432 2:48583005-48583027 CAGTCTTATTTCAAAGAGCAGGG - Intronic
930229572 2:48829135-48829157 CTGTGTTATTTCAGAGAGCCAGG - Intergenic
930477833 2:51906488-51906510 CAGTCTTATTTCATGCACAAAGG + Intergenic
930855534 2:56012966-56012988 CAGTGTTTTTTCTGAGACACAGG - Intergenic
931161908 2:59702188-59702210 CAGTCTTATTTAAGAGCCCTTGG - Intergenic
931343639 2:61426407-61426429 CAAGCTGACTTCAGAGACACTGG + Intronic
935138844 2:100333280-100333302 CTGTCTTATTACAAAGACAGAGG - Intergenic
935656893 2:105430796-105430818 CAGTCTTTTCTCCCAGACACAGG - Intronic
936635999 2:114258935-114258957 CAGTATTATTTTAGAAACATTGG - Intergenic
937776209 2:125778943-125778965 CAGTTTTATCTTAGACACACTGG - Intergenic
938257864 2:129874134-129874156 GGGTCTTATGTGAGAGACACAGG - Intergenic
939367965 2:141259268-141259290 CACTCTTGTTGCAGAGACAAAGG - Intronic
940163776 2:150744309-150744331 CAGTCTTTTTCAAAAGACACAGG + Intergenic
940851557 2:158692018-158692040 CTCTCTTATTTCAGAGATACTGG - Intergenic
942219558 2:173756083-173756105 CAGTCTTCTTTCAGTGGCATTGG - Intergenic
944372305 2:198999086-198999108 CTGTATTATTTCAGAGGCAATGG + Intergenic
945503902 2:210614062-210614084 CAGTCTTATTTCAGGATGACTGG + Intronic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
946111876 2:217427014-217427036 CAGTGTTATTTCAAAGACTATGG + Intronic
946216280 2:218186278-218186300 CAGTGTTATTTCCCAGAGACTGG - Intergenic
948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG + Intergenic
1169000180 20:2162873-2162895 CAGTCTTCTTTCAGAGCCAGTGG - Intronic
1169806048 20:9560188-9560210 CATGCTAATTTCAAAGACACTGG - Intronic
1170047019 20:12096289-12096311 AAGTGATAGTTCAGAGACACAGG + Intergenic
1170117545 20:12876661-12876683 CAATCTAATTTCAGAGTCTCTGG - Intergenic
1170945897 20:20890889-20890911 CTGTCTTCATTCATAGACACAGG + Intergenic
1171220734 20:23394524-23394546 CAGTCAGATTTCTGAGTCACTGG + Intronic
1171364286 20:24613239-24613261 CTGTCTTATCTCAGAGGCCCTGG - Intronic
1171393322 20:24815336-24815358 CAGGGTTATTTCAAAGACTCAGG - Intergenic
1172471384 20:35199448-35199470 AAGTCTTATTTAAGAAATACAGG + Intergenic
1172902231 20:38343786-38343808 CAGTCTTATTGCAGTGAAATAGG - Intergenic
1177586218 21:23099858-23099880 CAGTCTTAATTCATAAAAACTGG - Intergenic
1177597763 21:23267660-23267682 CTGTCTTTGGTCAGAGACACTGG + Intergenic
1177764500 21:25441428-25441450 CTGTCTTATTTCAGAGAACCAGG - Intergenic
1180713967 22:17859016-17859038 CTGACTTATTTCAGAGAAAGGGG + Intronic
1180859551 22:19069772-19069794 TAGTCTCATTTCTGAGACTCTGG + Intronic
1181038892 22:20182669-20182691 GAGACCTATTTCAGAGCCACAGG - Intergenic
950146816 3:10656093-10656115 CTGACTTATTTCAGAGGCAGTGG + Intronic
952991881 3:38837411-38837433 CAGCCTTTTCTCAGAGCCACTGG - Intergenic
953566708 3:44038151-44038173 AAGTCTTCTATCAGAAACACTGG - Intergenic
953832993 3:46317973-46317995 CTATCTTATTTCAGAGAACCTGG - Intergenic
956603187 3:71045255-71045277 CAGTAACATATCAGAGACACTGG - Intronic
957127557 3:76181422-76181444 AAGTCTTATTTTAGAAACAATGG - Intronic
962532044 3:136291533-136291555 CATTCATAGTTCAGAGGCACAGG - Intronic
963631464 3:147736194-147736216 TAGACTTATTTCAGAGATTCTGG + Intergenic
964567270 3:158070556-158070578 CAGTCTATTTTTAAAGACACTGG + Intergenic
965129191 3:164673044-164673066 CAGTCATAGCTCAGAGACAGAGG - Intergenic
966413085 3:179663375-179663397 CAGTCATCTGTCAGGGACACTGG + Intronic
967315184 3:188145389-188145411 CTGTCTTATTACAGACACATAGG + Intergenic
967322516 3:188208547-188208569 CGGGCTTATTTCAGAGAGACTGG + Intronic
970247181 4:14075735-14075757 CAGTTTTATTACAGAGTAACTGG - Intergenic
972209529 4:36820695-36820717 CAGTGTTAATTCTGAGACCCAGG - Intergenic
972576926 4:40360352-40360374 CAGTCTTATTTCTTAAACATTGG - Intergenic
974318162 4:60308612-60308634 AAATTTTATTTCAGAAACACTGG - Intergenic
974734010 4:65904816-65904838 CAGTCTGATTCAATAGACACAGG + Intergenic
978721315 4:111913310-111913332 AAGTTTTATTTCAGAGAAAAAGG + Intergenic
979743465 4:124179967-124179989 CCGGCTTTTTTCTGAGACACAGG + Intergenic
980407213 4:132368213-132368235 TAGTCTTATTTGACAGACAGTGG + Intergenic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
982499249 4:156132287-156132309 CTGTCTTATTTCAGAGAACGAGG - Intergenic
982713374 4:158781329-158781351 CACTCTGATTTCACAGAGACCGG - Intronic
983756112 4:171338731-171338753 CAGTCTAATTTTAGAGAAAAAGG - Intergenic
984122116 4:175758525-175758547 GAGTGTTATTTAGGAGACACTGG + Intronic
984622259 4:181967195-181967217 CAGCCTTATTTGAGATACATGGG + Intergenic
984640875 4:182163112-182163134 CATTCTTATTTCAGAGTTTCTGG + Intronic
986272949 5:6250083-6250105 GAGTCTCATTCCACAGACACGGG - Intergenic
989807796 5:45632232-45632254 AAGTCCTATTTCAGAGACTCAGG - Intronic
991236513 5:64405697-64405719 CAGTCTTATTTCAGTGACCTTGG - Intergenic
991371090 5:65920712-65920734 CACTCTTTTTTTAGAGACAAGGG - Intergenic
991653962 5:68884247-68884269 CAGTTTTGTTTCAGAGAGAGAGG - Intergenic
993561403 5:89415448-89415470 CATTCTTGTTTCAGAGTCGCTGG - Intergenic
995400212 5:111732697-111732719 CAGCATTATTTTAAAGACACTGG - Intronic
996638634 5:125726309-125726331 CTGTCTTATTTTAGAGAGAAAGG + Intergenic
996744132 5:126831125-126831147 AAGTCTCATTTCTGTGACACTGG + Intronic
997926769 5:138037468-138037490 AAGTCTCATTCCAGTGACACTGG - Intronic
999794204 5:154973119-154973141 CACACTTATTTAAGAGACAGGGG + Intergenic
999915138 5:156250435-156250457 CAGTATAATTTCAGAGGCAGAGG + Intronic
1000038995 5:157471162-157471184 CAGTCTAATTCCAGAGTCAGGGG - Intronic
1000911136 5:167023577-167023599 CAGTCATCCTTCAGAGATACAGG - Intergenic
1001110368 5:168891211-168891233 CAGTCTCATGTCTGAGACACAGG - Intronic
1003347872 6:5287506-5287528 CAGGCTAATTTCAGGGACACGGG - Intronic
1004011598 6:11693459-11693481 GACTTTTATTTCAGAGGCACAGG + Intergenic
1004475351 6:15966374-15966396 CTGTCTTTTTTCAGGGAAACTGG - Intergenic
1005675590 6:28151636-28151658 CAGTCTGACTTCAGGGACATCGG + Intronic
1009242743 6:61200729-61200751 CAGACTGTTTACAGAGACACAGG - Intergenic
1010332257 6:74637107-74637129 CAGTTTTATTTCAGAACTACAGG - Intergenic
1012445822 6:99306261-99306283 CAGTCTCATTTCATAGACCCCGG - Intronic
1016473819 6:144404347-144404369 TTGTTTTATTCCAGAGACACAGG + Intronic
1019860690 7:3655922-3655944 CAATCCTATTTCCCAGACACTGG - Intronic
1021952178 7:25785833-25785855 CAGTCCTGTTTGAGAAACACTGG - Intergenic
1022592474 7:31678790-31678812 CACTCTTATTTCACATATACTGG - Intergenic
1023241279 7:38150815-38150837 CAGTTTTATATCAGAGATATTGG - Intergenic
1024100416 7:46027041-46027063 AAGTGTTATTTCAGCAACACTGG + Intergenic
1024620578 7:51154028-51154050 CACTCATCTTTCAGCGACACGGG - Intronic
1024851175 7:53719063-53719085 GAATCCTATTTCAGAGACAAAGG - Intergenic
1026523403 7:71134782-71134804 CAGGCTTTTCTCAGGGACACAGG + Intronic
1028366097 7:90034373-90034395 CAGGCTAATTCCAGACACACTGG + Intergenic
1028392459 7:90332675-90332697 CATTCTTTTTTCAGGAACACAGG + Intergenic
1030139220 7:106287682-106287704 CAGTCTCCTTTCAGAGAAGCTGG - Intergenic
1031310244 7:120187385-120187407 CAATTTTTTTTCAGACACACTGG + Intergenic
1032989615 7:137378609-137378631 CAGGCTGATTGCAGAGACAAAGG - Intergenic
1033352596 7:140573745-140573767 CAGTCTTCTTTCACAGAGAAGGG + Intronic
1036089571 8:5650774-5650796 CAGTCTTTTTACTGAAACACTGG - Intergenic
1040380813 8:46869832-46869854 CTGTCTTATTTCAGAAATCCAGG - Intergenic
1041715342 8:60927073-60927095 CAGTCTTAATTTAGGGAAACAGG - Intergenic
1042176347 8:66040410-66040432 CATTCTTATTTCTTAAACACTGG - Intronic
1042553012 8:70011038-70011060 CAGTGTTATTTTTGAGATACTGG - Intergenic
1042737854 8:72008925-72008947 CATTTTTCTTTAAGAGACACTGG - Intronic
1045943137 8:107762794-107762816 CAGTCAGATTCCAGAGACAATGG + Intergenic
1047108194 8:121758530-121758552 CAGTCGTATTTGGGAGCCACTGG + Intergenic
1047235369 8:123037304-123037326 CACTCTAATTTCAGAAACACAGG - Intronic
1047981890 8:130192056-130192078 CTTTCTTATTTCAAAGACAAAGG + Intronic
1049042261 8:140121404-140121426 GAGTTTTATTTCAGAGCCATGGG + Intronic
1049326352 8:142023430-142023452 CCGTCTCATTTCAGAGTCCCCGG - Intergenic
1051759265 9:20443035-20443057 CAGTCCTATTTCTGAATCACTGG - Intronic
1051860204 9:21616015-21616037 TAATCTTATTTTAGAGACACTGG - Intergenic
1055331310 9:75186771-75186793 CTGTATTATTTCAGAGATGCTGG - Intergenic
1056279536 9:85027900-85027922 CATTATGATTTCAGAAACACTGG - Intergenic
1057895081 9:98902852-98902874 AATTCTTATTTCACAGACACTGG - Intergenic
1059247640 9:112862225-112862247 CAGTCCTGATTCAGAGACCCTGG + Intronic
1059281773 9:113140504-113140526 CAGTCTAATCTCAGAGACACTGG + Intergenic
1185642170 X:1594365-1594387 CTGTCCAATTTCAGAGGCACAGG + Intronic
1186304910 X:8245945-8245967 CAATATTATTTATGAGACACTGG - Intergenic
1187249499 X:17584069-17584091 TGGTCTTCTTACAGAGACACAGG - Intronic
1189671362 X:43413605-43413627 TATACTTATTCCAGAGACACTGG - Intergenic
1189675206 X:43454321-43454343 CAGTCTTTTGTCAGAGGTACAGG - Intergenic
1192091141 X:68157679-68157701 CAGTTTTATTTTAGATACAGGGG - Intronic
1192664652 X:73076812-73076834 CAGTATTTTCTCAGGGACACAGG - Intergenic
1193442012 X:81553193-81553215 AAGTCTTATTTTAGATACAGGGG - Intergenic
1194265817 X:91752781-91752803 CAGTTTTATTTGAAAGTCACGGG + Intergenic
1196202585 X:112902254-112902276 TAGTGTTATTTCAGTGACAATGG - Intergenic
1196273780 X:113742438-113742460 TAGCCTAATTTCTGAGACACTGG + Intergenic
1196353523 X:114761277-114761299 CAGACTTATTTCTGATCCACAGG - Intronic
1198009771 X:132539736-132539758 AAGCTTTATTTCAGAGGCACTGG - Intergenic
1200582964 Y:4973219-4973241 CAGTTTTATTTGAAAGTCACGGG + Intergenic
1201973559 Y:19821201-19821223 CTGTATTATTTCAGAGACCCAGG - Intergenic