ID: 948701617

View in Genome Browser
Species Human (GRCh38)
Location 2:239764239-239764261
Sequence GGGACCTGGGAAGAATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948701617_948701622 -5 Left 948701617 2:239764239-239764261 CCCTGGCATTCTTCCCAGGTCCC 0: 1
1: 0
2: 0
3: 31
4: 307
Right 948701622 2:239764257-239764279 GTCCCCAGCAAGGTCATCCTAGG 0: 1
1: 0
2: 1
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948701617 Original CRISPR GGGACCTGGGAAGAATGCCA GGG (reversed) Intronic
900417385 1:2541235-2541257 GGGAGCAGGGAGGAATCCCAGGG + Intergenic
900480676 1:2897566-2897588 GGGACCTGGGGATGTTGCCATGG - Intergenic
900511486 1:3063057-3063079 GGGACCTGAGAGGAAAGCCCAGG + Intergenic
900951665 1:5861590-5861612 GAGACCTGGGCAGAGGGCCATGG - Intergenic
902749648 1:18498816-18498838 GGGACCTTGAAGCAATGCCATGG + Intergenic
903861120 1:26365018-26365040 GGGACAGGGGCAGAAAGCCAAGG + Exonic
905409347 1:37757563-37757585 GGGAGCTGGGGACAATGCCAAGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
907781853 1:57574168-57574190 GGTCCCTGGGGAGAAGGCCATGG + Intronic
908155331 1:61347097-61347119 TGGACCTGGGAACAATCACAAGG - Intronic
908269595 1:62410242-62410264 GGAACCTGGGAATAAAGCCTTGG + Intergenic
909250349 1:73345008-73345030 GGGCCAGGGGAAGAATGACATGG + Intergenic
909265167 1:73549414-73549436 GGGGCCAGGGAAGAATGATATGG - Intergenic
910536423 1:88303292-88303314 GGTTCCTGTGAAGAATGCCAGGG - Intergenic
911880066 1:103225614-103225636 GGGTCAGGGGAAGAATGCTATGG + Intergenic
911897242 1:103452197-103452219 GGGAGTTGGAAAGACTGCCAAGG - Intergenic
912515494 1:110214110-110214132 GGTTCCTGGGAAGACTTCCAGGG - Intronic
912867605 1:113271948-113271970 GGGACTTGGGAAGAGTGGGAGGG - Intergenic
913233648 1:116762459-116762481 GGGAGATGGGAAGAATACCTGGG + Intronic
915602817 1:156932950-156932972 GGGCTAGGGGAAGAATGCCATGG - Exonic
915946690 1:160157877-160157899 GGTACCTGGAAAGAATACGACGG + Intronic
917284100 1:173406811-173406833 GGGACCTGGAGAGAATTCCCAGG + Intergenic
922936915 1:229430351-229430373 AGGACCTGGGAAGGAGGCAAGGG - Intergenic
923043021 1:230333237-230333259 GGGACCTGGGGAGATTGTCACGG - Intronic
923728897 1:236531896-236531918 GGCACCTGGGGTGAATTCCAGGG + Intronic
924004434 1:239592432-239592454 GGGAGGTGGGGAGAATGACATGG - Intronic
1065225841 10:23543072-23543094 GGGACCTGGGAAAAGTGAGAAGG - Intergenic
1066427696 10:35323625-35323647 GGGACCAGGGACGAGTACCAGGG + Intronic
1067549237 10:47221920-47221942 GGAACATGTGAAGAAAGCCAGGG - Intergenic
1069840977 10:71339265-71339287 GGGAGCTCTGCAGAATGCCAGGG - Intronic
1071357977 10:84817706-84817728 GGGGCCTGAGAACAAAGCCAGGG - Intergenic
1073347296 10:102793517-102793539 AGGAACTGGAAAGAATGCAATGG - Intronic
1074386448 10:113020304-113020326 GGCAGCTGGGAAGAAGGTCATGG + Intronic
1074659464 10:115636361-115636383 GTTACCTGGGAAGAATGGAAGGG - Intronic
1075788542 10:125066896-125066918 TGGAGCTGGGAAGACTGCCCAGG - Intronic
1076841328 10:133047302-133047324 GGCACCTGGAAAGGATGCCTGGG - Intergenic
1077250415 11:1558382-1558404 GGGATCTGGGACAAATTCCAAGG - Intronic
1077700930 11:4441789-4441811 GGGACTTGGGAAGAGTGGGAGGG + Intergenic
1078867691 11:15313103-15313125 GGGGCCTGGGTGGAATGCTATGG + Intergenic
1079246768 11:18758050-18758072 GAGACATGGGATGAAGGCCAAGG + Intronic
1079695556 11:23478000-23478022 AGGACCTGGGAGGACAGCCAGGG - Intergenic
1080622449 11:33997940-33997962 GGGCCCTGGCAAGACAGCCACGG + Intergenic
1080866823 11:36202812-36202834 GGGAGCTAGGAAGAAGGACACGG + Intronic
1081661687 11:44892328-44892350 GGGGCCTGGGAGGAATGGCGCGG - Intronic
1082795439 11:57375687-57375709 GGGCCCTGGGCACAAAGCCAGGG - Intergenic
1082941746 11:58712399-58712421 GTGACCTGGGAAGTATTCTATGG + Intronic
1083398795 11:62409936-62409958 GGGGCCTGGGAAGACTGCTGTGG - Intronic
1083647611 11:64181770-64181792 GGGACCTGGGAGGAGGGCCCTGG + Intergenic
1084062729 11:66686709-66686731 GGGATCTGGGAAGACCTCCAGGG - Intronic
1084456647 11:69271552-69271574 GGGAGGAGGGAAGAATGGCAGGG + Intergenic
1085888212 11:80545804-80545826 GGGACCAGAGAAAAAAGCCATGG + Intergenic
1087587230 11:100137890-100137912 GAGAACTGGGAAGACAGCCAGGG + Intronic
1088749393 11:112831142-112831164 GGGACCTTAGAAGAATGCTGTGG - Intergenic
1090392463 11:126397990-126398012 GGGACTGGGGCAGAATGCTATGG - Intronic
1090676921 11:129007367-129007389 GATACCTGGGTAGTATGCCATGG - Intronic
1090717411 11:129442553-129442575 GGGACCTGAGAAGGATGCCTGGG - Intronic
1091038410 11:132254519-132254541 GGGACTTGAGAACAATGCCACGG - Intronic
1091694481 12:2618547-2618569 AGGCAGTGGGAAGAATGCCAGGG + Intronic
1091879541 12:3965771-3965793 GGGACCTTGGAGGAATTCAAAGG + Intergenic
1093478872 12:19584190-19584212 GGGACTGGGGCAGAATGACATGG + Intronic
1094785673 12:33846066-33846088 GGGCCAGGGGAAGAATGACATGG - Intergenic
1095189929 12:39246003-39246025 GGGGCCTGCGAAGAAGGCCTGGG - Intergenic
1095985666 12:47997823-47997845 GGGACCTGGGAAGTCCACCAGGG + Intronic
1096101586 12:48973272-48973294 AGGACCTGGCAGGAATCCCAGGG - Intergenic
1096647155 12:53045143-53045165 GGGCTCTGGGATGGATGCCATGG - Intergenic
1096707438 12:53431159-53431181 GGGTCCTGGGGGGAATGACAGGG - Exonic
1097074565 12:56383425-56383447 GGGATCTGGGGAGAACCCCAGGG - Intergenic
1097183510 12:57184236-57184258 GGGCCATGGGCAGAATGACAAGG - Intronic
1097193388 12:57231003-57231025 GGGACCTGGGGAGATGGGCAGGG + Intronic
1101076345 12:101133412-101133434 GGGACCTTGGCAGCATACCATGG - Intergenic
1103335841 12:120189051-120189073 GGGAGGGGGGAAGAAGGCCATGG + Intronic
1103726114 12:122998146-122998168 GGGGCCTGGGGAGAATGACTTGG - Intronic
1104667229 12:130656217-130656239 GGGACCCGGCAAGAATCACAAGG + Intronic
1104801117 12:131555877-131555899 GGGTCCAGGGGAGGATGCCAGGG - Intergenic
1104910294 12:132237010-132237032 AGGACCTGGGCGGAATCCCATGG - Intronic
1105694244 13:22872321-22872343 GGGCCCAGGGAAGAATGATATGG + Intergenic
1106158508 13:27179621-27179643 GGGACTTGGGAAGAAGGGCAGGG + Intergenic
1106272218 13:28166009-28166031 GGGATCGGGGCAGAATGCAATGG - Intronic
1106888405 13:34215846-34215868 GAGACCTGGAAAGAAAGGCAAGG - Intergenic
1107088039 13:36446964-36446986 AGGACCTGGGAAGGAGGCCATGG + Intergenic
1107555806 13:41516003-41516025 GGGGGCTGGCAGGAATGCCACGG + Intergenic
1108592631 13:51924516-51924538 GGGTCCTAGGAAGAATAACAGGG - Intergenic
1111343223 13:86914721-86914743 GGGCCCTGGGCAGAATGGTATGG + Intergenic
1113030590 13:105989963-105989985 GGGACCTAGGAAGAACACAAGGG - Intergenic
1113128721 13:107010142-107010164 TGGACCTGGGAAGAAAGACAAGG - Intergenic
1113634998 13:111913358-111913380 GGGCCCTGGGAAGAGTGCACAGG + Intergenic
1114632678 14:24169563-24169585 GTGACAGGGGAAGAATGGCAAGG - Intergenic
1116100613 14:40429231-40429253 AGGACCTGGGAAAAATAGCAGGG - Intergenic
1117330025 14:54703173-54703195 GTGGCCTGGTGAGAATGCCATGG + Intronic
1117780268 14:59224714-59224736 GGGGCAGGGGCAGAATGCCATGG + Intronic
1118391652 14:65300720-65300742 CGGAACAGGGAAAAATGCCAAGG + Intergenic
1119133255 14:72193872-72193894 GGGACCAGGGATGCATGCAAAGG + Intronic
1120239881 14:81937952-81937974 GGGAAATGGGAAGACTGCCAAGG + Intergenic
1121981763 14:98460657-98460679 TGGACCTGGGAAAAAGGCCATGG + Intergenic
1122500250 14:102193258-102193280 GGGGCCTGGGACGATGGCCACGG - Intronic
1123063709 14:105605915-105605937 GCAACCAGGGACGAATGCCATGG - Intergenic
1123775528 15:23575484-23575506 GGGGTCGGGGCAGAATGCCATGG + Intronic
1124637784 15:31375896-31375918 GGGGCCTGGGAATAAAGTCAGGG - Exonic
1125239621 15:37558692-37558714 GGGACCAGAGAACAAAGCCAAGG + Intergenic
1126963801 15:54028591-54028613 GGGCACTGGGAAAAATGCCAAGG - Intronic
1127813287 15:62582816-62582838 TGGGCCTGGGAAGGCTGCCACGG + Intronic
1127827638 15:62718945-62718967 GGGGCCTGGGAAAAATTCCATGG + Intronic
1128816186 15:70610281-70610303 GGCTCCTGGGAAGAAGGTCAGGG - Intergenic
1128905681 15:71465917-71465939 AAGGCCTGGGAAGAAGGCCAAGG + Intronic
1129196828 15:73973434-73973456 GTGCCCTGGGAAGAAGGGCAAGG - Intergenic
1129653296 15:77506597-77506619 GGGTTCTGGGAAGGAAGCCAAGG + Intergenic
1130230743 15:82094906-82094928 GGGAGGTGGGAAGAATGATAGGG + Intergenic
1130620417 15:85456125-85456147 TGTACCTTGGAAAAATGCCATGG - Intronic
1130969113 15:88718472-88718494 GGGAGAGGGGAAGAAGGCCAGGG - Intergenic
1132888525 16:2193365-2193387 GGGACCTGGGAATTATGTCGTGG + Intronic
1133595074 16:7283282-7283304 GGGACCAGGGAGGAAGGCCATGG - Intronic
1135752409 16:25067492-25067514 GGGACCCGGGAGGAATGGAAAGG + Intergenic
1137882723 16:52069095-52069117 GTGAGCTGGGAAGAATGCAGTGG - Intronic
1138113790 16:54344453-54344475 GTGACCTGGGGAAAATGGCAGGG + Intergenic
1138248621 16:55485406-55485428 TGGACCTTGGGAGAAGGCCAAGG + Exonic
1138722039 16:59093234-59093256 TGGAACTGCTAAGAATGCCAAGG - Intergenic
1139369356 16:66457053-66457075 GGGAGCAGGGAACAGTGCCAGGG + Intronic
1139648505 16:68349253-68349275 GGGACACGGGGAGAGTGCCACGG - Intronic
1140456023 16:75106075-75106097 GGGAAGTGGGAACAATGGCATGG - Intronic
1142151425 16:88514261-88514283 GGGGCCTGGGGTGAATGGCAGGG - Intronic
1144429295 17:15175583-15175605 AGGACCTGGGAAGAAGTCCAGGG - Intergenic
1144499977 17:15778103-15778125 GGGACTGGGGAAGAATGATATGG - Intergenic
1145990027 17:29073749-29073771 GGGAGGTTGGAAGAATGACACGG + Exonic
1146284460 17:31565138-31565160 AGGATCTTAGAAGAATGCCAAGG - Intergenic
1146367566 17:32240951-32240973 GGGACCTGGGAAGTCAGCCAAGG + Intronic
1147552277 17:41452167-41452189 AGGGCCTGGGGAGAATTCCATGG - Intergenic
1147728255 17:42580316-42580338 GGCCCCTGGGATGAATGACATGG + Exonic
1147864681 17:43544832-43544854 GGGACCTGGGGAGAGGGCCTTGG + Intronic
1147977192 17:44254674-44254696 GGTAGCAGGTAAGAATGCCAAGG + Intronic
1148052958 17:44778134-44778156 GGGACCTGGGGAGGATGGCAGGG - Exonic
1148744326 17:49910112-49910134 GGGACGTGGGGAGGAGGCCAGGG - Intergenic
1150486959 17:65550599-65550621 GGGACCAGTGGAGGATGCCAGGG - Intronic
1151119544 17:71777294-71777316 GGGAGCTGGGGAGAAAGACAAGG - Intergenic
1151244429 17:72783648-72783670 GGGGGCAGGGAAGAATGCCCAGG + Intronic
1152582609 17:81173237-81173259 GGGGCCAGGGAACCATGCCAGGG - Intergenic
1152611414 17:81316596-81316618 GTGTCCTGGACAGAATGCCAAGG - Intronic
1152984685 18:311097-311119 GGGCCCTGGGAAGACTGTGAAGG - Intergenic
1154313493 18:13285224-13285246 AGTTCCTGGGGAGAATGCCAGGG + Intronic
1156151486 18:34249205-34249227 GGGACCAGGGCAGAATGATATGG - Intergenic
1157437253 18:47681271-47681293 GGAAGCTGGGACTAATGCCAGGG - Intergenic
1157522913 18:48357524-48357546 GGCACCTGGGGAGAATTCCTGGG - Intronic
1158908240 18:62034913-62034935 GGGGCCGGGGGAGAATGCTATGG + Intergenic
1159118382 18:64140867-64140889 GTGACCAGGGAAGAAAGACACGG + Intergenic
1160396480 18:78575955-78575977 GGTACCTAGGAAGAATGGCCTGG - Intergenic
1160601226 18:80014158-80014180 GGGGCCGGGGAAGAATGATATGG - Intronic
1161558077 19:4955619-4955641 GGGAGCTGGGGAGAAAGCCCTGG - Intronic
1161818707 19:6516194-6516216 GGGGCCTGGGGAGAATGACAGGG + Intergenic
1161927604 19:7312880-7312902 GGGAGCTGAGAAGAATGGCAGGG - Intergenic
1165062580 19:33212134-33212156 TGGCCCTGGGAAGAAAGCCGGGG - Intronic
1165112255 19:33509275-33509297 GGCCCCTGGGAAGAAGGGCACGG - Intronic
1165168513 19:33873638-33873660 GAGACCTGGGAAGAGTGCTGCGG - Intergenic
1167356356 19:49006657-49006679 GGGACCAGGGACGAAGGCCAAGG - Intronic
1168156223 19:54474209-54474231 GGGACCGCGGAGGAATGGCAGGG + Intergenic
925596193 2:5557918-5557940 GGGACCAGGGCAGAATGATATGG - Intergenic
926089782 2:10042772-10042794 GGGGCCTGGGAAGAATGGGCGGG + Intergenic
927516421 2:23674441-23674463 GGGGTCAGGGCAGAATGCCAGGG - Intronic
927516567 2:23675092-23675114 GAGACCTTGGGAGAAGGCCAGGG - Intronic
927884819 2:26711915-26711937 GGGTCCTGGGGAGATTGCCTGGG + Intronic
929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG + Intergenic
930256631 2:49100865-49100887 GGGACCAGGGAAGAAAACCAGGG + Intronic
930293837 2:49529484-49529506 GGGGCCAGGGAAGAATGATATGG - Intergenic
930544221 2:52746449-52746471 GGGGCCAGGGGAGAATGACATGG + Intergenic
930685135 2:54299783-54299805 GGGGCCTGGGATCAATGCCTGGG - Intronic
931267272 2:60671681-60671703 GAGACCTGGGAAGATTGTAAAGG - Intergenic
931363803 2:61601349-61601371 AGGACCTGAGAAGATTGCAAGGG + Intergenic
931604255 2:64036357-64036379 GGGAGCTGGGAAGGAGCCCAGGG - Intergenic
932497394 2:72153214-72153236 AGGCCCTGGGAAGAATGAGAAGG - Intergenic
933181419 2:79231156-79231178 GGGGCCAGGGAAGAATGATATGG + Intronic
933798593 2:85941847-85941869 GGGGCCAGGGAAGAATGATATGG - Intergenic
936980811 2:118263551-118263573 GAGACACAGGAAGAATGCCATGG + Intergenic
937068727 2:119044582-119044604 GGGACTTGGGAAGAGTGGGAGGG - Intergenic
937453266 2:122019890-122019912 GAGACCTGGGAAGAAGCACATGG - Intergenic
939175323 2:138741210-138741232 GGGACCAGGGAAGCATGCAGGGG + Intronic
941590766 2:167417363-167417385 GGGAACTGGGCAGAGTCCCAAGG - Intergenic
941653696 2:168120917-168120939 GGAATCTGGGAAGTTTGCCAGGG - Intronic
941921078 2:170851408-170851430 GAGACCTGTGAAAAATTCCAAGG - Intronic
942060192 2:172222342-172222364 GGGACTTGGGAAGCATGGGAGGG + Intergenic
942140374 2:172971569-172971591 GGGAGATGGGAAAAATCCCAAGG - Intronic
942383822 2:175420919-175420941 GGAACCTGGGAAGAAAGCTCTGG - Intergenic
942615996 2:177792939-177792961 AGGAGGTGGGAAGAATGGCAGGG + Intronic
944478655 2:200132456-200132478 GGGCTATGGCAAGAATGCCATGG + Intergenic
946148275 2:217747250-217747272 GGCAGCTGGGGAGAAGGCCAGGG - Intronic
946394307 2:219435463-219435485 GGCACCTGGGAAGAAGGCGGCGG - Intronic
946644922 2:221823178-221823200 GGCACCTGGGAAAACTGGCATGG - Intergenic
947158635 2:227189148-227189170 GGGAGCTGGGGAGAAAGGCAGGG + Intronic
947582740 2:231331761-231331783 GAGACATGGGGTGAATGCCATGG - Intronic
947628317 2:231635090-231635112 GGGACCTTGGAATGAGGCCAGGG - Intergenic
948248156 2:236503770-236503792 GGGACCTGGGCACCATGCCTCGG + Intronic
948701617 2:239764239-239764261 GGGACCTGGGAAGAATGCCAGGG - Intronic
1168816287 20:739493-739515 GGGTCCTTGGAAGTATGTCAGGG + Intergenic
1168889797 20:1287639-1287661 GGTACCTGGGGTAAATGCCAGGG + Intronic
1169329716 20:4706682-4706704 GGGCCCTGGGAAGAAGGTGAGGG - Intergenic
1170953769 20:20959651-20959673 GGGAGCTGGCAAGCATGGCAAGG + Intergenic
1171135368 20:22690427-22690449 GGGACCTAGAATTAATGCCAGGG - Intergenic
1172514525 20:35523692-35523714 GGGCACTGGGCTGAATGCCAAGG - Intronic
1172647402 20:36479540-36479562 GGGGCCTGGGAAGACTGTTAGGG + Intronic
1172974887 20:38898962-38898984 GGGAGCCAGGAAGAAAGCCAGGG + Intronic
1173711156 20:45156689-45156711 GGGGCCGGGGCAGAATGCTATGG + Intergenic
1174403849 20:50291306-50291328 GGGAGGTGGGGAGGATGCCATGG + Intergenic
1176079726 20:63266454-63266476 AGGAAATGGGAAGAATGTCAGGG - Intronic
1177465446 21:21473218-21473240 GGGACCTGGCTTGAATACCATGG - Intronic
1178805763 21:35837728-35837750 GGGGCCGGGGCAGAATGACATGG + Intronic
1180959030 22:19754417-19754439 GGGGCCTAGGAAGAGTCCCAGGG + Intergenic
1181527816 22:23500229-23500251 GGGCACAGGGGAGAATGCCATGG + Intergenic
1181853124 22:25764299-25764321 GGAACCTGGGCAGGATGACAAGG + Intronic
1182150573 22:28024426-28024448 AGGAAATGGGAAGAATGGCAAGG + Intronic
1185111481 22:48902496-48902518 GAGAGCTGGGGTGAATGCCAGGG + Intergenic
950099960 3:10350573-10350595 GGGACCTGGGCAGGAGGGCAGGG + Exonic
950961628 3:17114192-17114214 GGGGCCTGGGCAGAATGATATGG - Intergenic
951587412 3:24229664-24229686 TGACCCAGGGAAGAATGCCAAGG + Intronic
951765626 3:26195202-26195224 GGGCCCTGGGAAGAACTCCTGGG - Intergenic
952585514 3:34887574-34887596 GGGGCCAGGGCAGAATGCTACGG + Intergenic
952839377 3:37631172-37631194 GGGTCCTGGGAAGAATTTCAGGG + Intronic
953136384 3:40185805-40185827 GGGCCCTGGGAGGAATCCAAAGG - Intronic
953768864 3:45763753-45763775 GGGGCCTGGGATGAAGGCCCAGG - Intronic
953826804 3:46260243-46260265 GGGGCCGGGGTAGAATGACATGG - Intronic
954275120 3:49536859-49536881 GGGATCTGGCAGGAGTGCCAGGG - Intergenic
956272376 3:67461823-67461845 AGAACCTGGGAAGATTTCCAAGG + Intronic
956695942 3:71919575-71919597 GAGAGCTGGAGAGAATGCCAGGG + Intergenic
957425770 3:80036967-80036989 AGGACCTAAGAAGAATGCAAGGG + Intergenic
957995990 3:87690844-87690866 AAGACATGGGGAGAATGCCATGG + Intergenic
958175586 3:89991850-89991872 GGGGCCAGGGAAGAATGATATGG + Intergenic
960358406 3:116680435-116680457 GGGCCAGGGGCAGAATGCCATGG + Intronic
960660287 3:120050579-120050601 GGTTCCTGGGAAGGAAGCCAGGG + Intronic
962280530 3:134048690-134048712 GGGACCTGGGGAGAAATTCACGG - Intronic
963816533 3:149837756-149837778 GGGGCCAGGGCAGAATGACATGG - Intronic
964123873 3:153215913-153215935 TGAAACTGGCAAGAATGCCAGGG - Intergenic
964844530 3:161031281-161031303 GTGACCTGGAAAGAAAACCATGG + Intronic
968161589 3:196431871-196431893 GGGACCGGGGCAGAATGACCTGG + Intronic
968232339 3:197011328-197011350 GGGTCCTGGGAAGAAGGCACTGG - Intronic
968447396 4:658597-658619 GGGACCTCGGGGGCATGCCAGGG - Intronic
968575912 4:1366045-1366067 GGGACCTGGGGAGTCAGCCAGGG + Intronic
968769750 4:2497114-2497136 GGAAACTGGTAAGATTGCCAGGG + Exonic
968844328 4:3031525-3031547 GGGAGCTGGGCTGCATGCCAGGG + Intronic
969637772 4:8379287-8379309 GGGCCCTGGGCTGAATGCTAAGG - Intronic
972365542 4:38371159-38371181 GGAACCTGAGAAGGATGCAAAGG - Intergenic
972767236 4:42162626-42162648 GGGACGTAGGGAGAATGTCATGG - Intergenic
975040336 4:69738637-69738659 GGGACCATGGAAGAATGATATGG - Intronic
975601176 4:76101080-76101102 GGGAACAGGGAAGAATGTCGTGG + Intronic
975695316 4:77007211-77007233 GGGAGCTGGGAAGAGAGCCGGGG + Intronic
977430230 4:96922930-96922952 GAGTTCTGGGCAGAATGCCAGGG - Intergenic
977721290 4:100243128-100243150 GGGAGCTAGGAAGATTGCCTGGG + Intergenic
978313709 4:107413854-107413876 GGGACCAGGTAAGAAAGCCATGG + Intergenic
978526983 4:109677462-109677484 GGGGCCGGGGCAGAATGCTATGG + Intronic
978631702 4:110754459-110754481 GGCACATTGGAAGAATGGCAAGG + Intergenic
979182961 4:117753933-117753955 GGGGCCAGGGAAGAATGATATGG + Intergenic
979532835 4:121787350-121787372 GGAACATGGAAAGAATGCAAAGG + Intergenic
979860395 4:125686307-125686329 GGGATCTGGGCAGAATGCTATGG - Intergenic
979995921 4:127430808-127430830 GGGACTTGGGAAGAGTGGGAGGG + Intergenic
982024053 4:151234445-151234467 GGGTCCTGGGAAGTAAGGCAGGG + Intronic
983300762 4:165922476-165922498 GAGACATGGGAAGAAAGGCAGGG - Intronic
985106401 4:186504316-186504338 GTGTCCTGATAAGAATGCCAGGG - Intronic
985395543 4:189539318-189539340 GGGACCAGGGAGAAAAGCCAGGG + Intergenic
985903702 5:2816608-2816630 GGGTCCTGGGAAGGAAGCCAGGG - Intergenic
986311331 5:6553142-6553164 GGGAACTGGGCAGAGTGACACGG + Intergenic
986609534 5:9552778-9552800 GGGTCAGGGGAAGAATGCTATGG - Intergenic
986965347 5:13263720-13263742 AGAATCTGCGAAGAATGCCAAGG + Intergenic
990181431 5:53164787-53164809 GGGAGCGGGGAAAAATGACAAGG - Intergenic
991074871 5:62523847-62523869 GGGACATGAGAAGACAGCCAAGG + Intronic
993953015 5:94199366-94199388 GGGACCAGAGAACAAAGCCAAGG - Intronic
994332474 5:98523329-98523351 GGGACTTCGGGTGAATGCCAAGG - Intergenic
994377735 5:99034267-99034289 GTGACCTAGGAAGACTCCCAGGG - Intergenic
995011279 5:107259550-107259572 GGGACCAGGGCAAAATGACACGG - Intergenic
995241243 5:109887201-109887223 GGGACCTGGGAAGGAGGGCAGGG - Intergenic
997665743 5:135628327-135628349 GGAACCTGGGGAGAATCCCTCGG + Intergenic
997832255 5:137160112-137160134 GGGACTTGGGAAGAGTGGGAAGG - Intronic
999444457 5:151628269-151628291 GGGACCAGGGGAGCCTGCCATGG - Intergenic
1000197894 5:158977735-158977757 GTGACTTAGTAAGAATGCCATGG + Intronic
1001401774 5:171450502-171450524 GGGACCTGGGACAAGTGCCCGGG - Intronic
1002344498 5:178537934-178537956 GGTACCTGGGGTGAGTGCCAGGG - Intronic
1002782728 6:379682-379704 GTGACCTGTGCAGAATGCCGGGG - Intergenic
1003651874 6:7968468-7968490 GTGACCTGGGAAGAATGCTGGGG - Intronic
1004447359 6:15712396-15712418 GGGAGCTGGGAAGGATGAGAAGG - Intergenic
1007597884 6:43062821-43062843 GGGACGTGGCAAGACTGGCAGGG - Intronic
1007740171 6:44005084-44005106 GTGTCCTGGGAGGAATGCCTGGG - Exonic
1009545919 6:65020105-65020127 GGGGCCAGGGTAGAATGACATGG - Intronic
1010727586 6:79352973-79352995 GGGATCTGGGAAGAAGGAGAGGG - Intergenic
1012125186 6:95420043-95420065 GGGTCAGGGGAAGAATGACATGG - Intergenic
1013990976 6:116253558-116253580 GATACCGGGGAAGAAGGCCAAGG - Exonic
1016493898 6:144637529-144637551 GGTACTTAGGAAGAATCCCAGGG - Intronic
1018310929 6:162507805-162507827 CGGATCTGTGCAGAATGCCAAGG - Intronic
1018569491 6:165194285-165194307 GGGTAATGGAAAGAATGCCAAGG - Intergenic
1019046949 6:169156674-169156696 AGGACCTGGGAAGACTGTCTTGG - Intergenic
1022865833 7:34418897-34418919 GGGCCCTGGGTTAAATGCCAGGG - Intergenic
1023842665 7:44105841-44105863 GGGTCCTGGGAGGATTCCCATGG + Intronic
1025994336 7:66518641-66518663 GGGGTGTGGGCAGAATGCCAGGG - Intergenic
1026033665 7:66816022-66816044 GGGGTGTGGGGAGAATGCCAGGG + Intergenic
1026525106 7:71146544-71146566 GGCCCCTGGGAAGAAGTCCAGGG + Intronic
1026985946 7:74555330-74555352 GGGGTGTGGGGAGAATGCCAGGG - Intronic
1027250374 7:76395177-76395199 GGGAACTGGGAAGAATGTTCTGG - Intronic
1027783451 7:82549811-82549833 GTTCCCTGGGAAGAATGACAAGG + Intergenic
1029916836 7:104218856-104218878 GAGGCTTGGGGAGAATGCCAAGG + Intergenic
1031869682 7:127078227-127078249 GGGACCAGGAAAGGCTGCCAGGG - Intronic
1031873041 7:127108283-127108305 AGGACCTGGGAAGGAAACCATGG + Intronic
1032297246 7:130650778-130650800 GGGTCCTGGGAAGGAAGCCAGGG - Intronic
1032706942 7:134428744-134428766 GGAAACTGGGAAGGATGGCAGGG - Intergenic
1034034913 7:147808990-147809012 GGGATCTGGGAAGAATGGTTTGG + Intronic
1034074737 7:148220916-148220938 GGGACCTGAGAAGAAACCCAAGG - Intronic
1034532143 7:151702476-151702498 GGGACCTGGCAAGACTGCCGTGG - Intronic
1035380539 7:158437655-158437677 GGGACCTGGGATGTGTGCGATGG + Intronic
1038380557 8:27089228-27089250 GGGCCATAGGAAGAATGCTATGG - Intergenic
1039386014 8:37136115-37136137 TAGACCTGGGAAGAATGTGAAGG + Intergenic
1042494460 8:69440584-69440606 GGGACCTGGGAAGGGCCCCAAGG - Intergenic
1043028914 8:75106623-75106645 GGTGCCTGGGAAGAAGGGCAAGG - Intergenic
1047962313 8:130019444-130019466 GGAACCTGGGAATAATACCCGGG + Intergenic
1048816507 8:138339468-138339490 TGAAGCTGGGCAGAATGCCAGGG + Intronic
1048915961 8:139182825-139182847 GGAACCAGGGAGGAATGACATGG + Intergenic
1049172365 8:141169500-141169522 GGGACGTGGGACAAATGCCAGGG + Intronic
1049202351 8:141346516-141346538 GGGACCTGGAGAGAAGGCGAAGG + Intergenic
1050238683 9:3611951-3611973 GGGACCAGGGACCAATCCCAGGG - Intergenic
1050774204 9:9239654-9239676 GGGATCTGGGCAGATGGCCATGG + Intronic
1053139432 9:35673603-35673625 TGGAGCTGGGAAGCAGGCCAGGG + Intronic
1053422378 9:37987718-37987740 GGGGCCTGGGAGGAAAGCCTGGG + Intronic
1055033496 9:71793903-71793925 GTGAACTGGGAAGAATGCACTGG + Intronic
1055073380 9:72189902-72189924 AGGACCAGGGCAGAATGCTATGG + Intronic
1057280013 9:93702394-93702416 GGCACCTGTGAGGAATGCCTGGG + Intergenic
1057729476 9:97596280-97596302 GAGACTTGGGATGAGTGCCAGGG - Intronic
1059626618 9:116073896-116073918 GGGGCCTGGGATGATGGCCAAGG - Intergenic
1060720046 9:125970592-125970614 GGGACTTGGGAAGACACCCATGG - Intergenic
1062080098 9:134619204-134619226 GTGACCTGTGAAGACTGGCAGGG + Intergenic
1185776738 X:2809242-2809264 GGAACCAGGGAAGGATGCAATGG + Intronic
1185838650 X:3368512-3368534 GGGACCAGGGAACAAAGCTAGGG - Intergenic
1186567006 X:10673664-10673686 GAGATCTGGGAAGAAAGACATGG + Intronic
1186766882 X:12779678-12779700 GTGACCTTGAAGGAATGCCAAGG + Intergenic
1187290452 X:17948368-17948390 GGGAGCAGGGAAGCATGGCAGGG - Intergenic
1188299297 X:28487749-28487771 GGTACCTGGGGAGAATGAGAAGG - Intergenic
1188517451 X:31002949-31002971 GGGTCAGGGGAAGAATGCTATGG - Intergenic
1188572040 X:31599384-31599406 AGGTGCTGTGAAGAATGCCAAGG - Intronic
1190942288 X:55053669-55053691 TGGACATGGGAAGAATTCCTGGG - Intergenic
1192224224 X:69217355-69217377 GGCAGCTGGAAAGAAGGCCAGGG - Intergenic
1194189929 X:90822308-90822330 GGGGCAGGGGAAGAATGCCGTGG + Intergenic
1195579417 X:106484384-106484406 TGAACCTGGGGAGAATACCAAGG - Intergenic
1196036267 X:111148824-111148846 GGGGCCGGGGCAGAATGACATGG - Intronic
1196317818 X:114249952-114249974 AGGACGTGGGAAGAATGAGATGG + Intergenic
1196723594 X:118876863-118876885 GGGACCAGAATAGAATGCCATGG + Intergenic
1196816964 X:119672603-119672625 GAGTTCTGGGAAGAATGCCAAGG + Intronic
1197424636 X:126280629-126280651 GGGACCTGGGAAGATTTCTTAGG - Intergenic
1201071014 Y:10147352-10147374 GAGGCCTGGGCAGAATGACAGGG + Intergenic
1201293256 Y:12442227-12442249 GGAACCAGGGAAGGATGCAATGG - Intergenic