ID: 948701755

View in Genome Browser
Species Human (GRCh38)
Location 2:239765049-239765071
Sequence CGGGGGAATCAGCACCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948701755_948701761 -2 Left 948701755 2:239765049-239765071 CCAGCCTGGTGCTGATTCCCCCG 0: 1
1: 0
2: 0
3: 15
4: 155
Right 948701761 2:239765070-239765092 CGAACTGATCTTTCTCCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948701755 Original CRISPR CGGGGGAATCAGCACCAGGC TGG (reversed) Intronic
900193415 1:1361341-1361363 CTGGGGACTCAGCACTAAGCCGG + Intronic
900227366 1:1539593-1539615 CGGGGGAACCAGCCCCACGCAGG - Intronic
901180947 1:7341550-7341572 CAGGGGAGCCAGCTCCAGGCTGG - Intronic
901768470 1:11518577-11518599 CTGGGGAGACAGCCCCAGGCCGG - Intronic
901877929 1:12177506-12177528 CAGGGGTAGCAGCGCCAGGCAGG - Intronic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
902839750 1:19067375-19067397 CCTGGGAACCAGCTCCAGGCCGG - Intergenic
902916823 1:19644520-19644542 CGGGGGACGCAGCTCCGGGCTGG - Intronic
905342667 1:37289995-37290017 CCGGGGAATGAGCACTGGGCTGG - Intergenic
905889473 1:41510531-41510553 CGGGGAACCCAGGACCAGGCAGG - Exonic
908640528 1:66218056-66218078 CTGGGGAATCAGCATTAGCCTGG + Intronic
909965580 1:81905304-81905326 CAGGGGATTCAGGACCAGCCTGG - Intronic
915038623 1:152949020-152949042 CAGGAGAGGCAGCACCAGGCTGG + Intergenic
915166116 1:153948591-153948613 AGGGGGATCCAGCACCAGGCTGG + Exonic
915530844 1:156501157-156501179 CGGTGGCAGCAGCGCCAGGCGGG - Intergenic
920185653 1:204157565-204157587 GAGGGGAATCAGCTCCAGACGGG - Intronic
922857633 1:228788722-228788744 CAGGGAAGTCGGCACCAGGCAGG - Intergenic
1063566965 10:7179772-7179794 TGGGGGAAACAGAACCAGGCTGG + Intronic
1064330360 10:14388201-14388223 TGGAGGATTCAGCACCAGACCGG - Intronic
1065519572 10:26558569-26558591 CCGGGGTTTCAGCACCAGACTGG + Intronic
1067521777 10:47013197-47013219 TGGGGAGACCAGCACCAGGCTGG + Intergenic
1071871309 10:89797610-89797632 TGGAGGAATCATCACCAGACTGG - Intergenic
1073048561 10:100654033-100654055 CGGGGGAGCGAGGACCAGGCTGG - Intergenic
1074690209 10:115997552-115997574 CGAGGGACTTAGCACAAGGCTGG + Intergenic
1075597297 10:123741477-123741499 TGGGGGGATCAGCACCACCCTGG - Intronic
1076132420 10:128022489-128022511 TGGGGGAGTCAGCACGGGGCAGG - Intronic
1076403342 10:130197308-130197330 AGGGGGGAGCAGCACCTGGCAGG + Intergenic
1077017502 11:403461-403483 GGGGGGAATCAGCCGCAGCCCGG - Intronic
1077265737 11:1648624-1648646 CGTGGGCATCAGCAGCAGGCAGG - Intergenic
1085259802 11:75197968-75197990 TGGGGGCAGCAGCATCAGGCTGG + Intronic
1088876632 11:113941745-113941767 CAGTGGAGTCAACACCAGGCAGG + Intronic
1089144276 11:116313070-116313092 CGGGAGAGGCAGCACCAGCCCGG + Intergenic
1089255951 11:117193942-117193964 CCAGGGACTCAGCACCTGGCAGG + Exonic
1090659242 11:128870245-128870267 TGGGGGAAAGAGCAACAGGCGGG + Intergenic
1091295015 11:134467586-134467608 CGGAGGATTCACCACCAGACTGG - Intergenic
1091650476 12:2305388-2305410 CAGGGGAAGGAGCACCAGGCTGG - Intronic
1091683272 12:2541947-2541969 CGGGGGCCTCAGGAACAGGCCGG + Intronic
1100815269 12:98380929-98380951 CTGGTGAACCAGCACCAGGCAGG + Intergenic
1101889710 12:108702280-108702302 GGGGGGAAACAAAACCAGGCTGG + Intronic
1102437803 12:112938847-112938869 CGGGGGAGTTAGCACGGGGCTGG - Intronic
1103703358 12:122859151-122859173 CAGGGGTGTCCGCACCAGGCTGG - Exonic
1104602775 12:130164126-130164148 CAGGGGAATGAGCACGAAGCCGG - Exonic
1105614299 13:21998519-21998541 TGGGGAATTCAGCCCCAGGCAGG + Intergenic
1107019564 13:35737578-35737600 CGGGGGATTCAGAACCAGCCTGG + Intergenic
1109174255 13:59135812-59135834 GGGGTGAATCAGGAGCAGGCTGG - Intergenic
1112290689 13:98142666-98142688 CAGGCGAAGCAGCCCCAGGCAGG + Exonic
1112371602 13:98798474-98798496 GGTGGAACTCAGCACCAGGCTGG + Intronic
1113492977 13:110706431-110706453 CGGCGGACACAGCTCCAGGCTGG - Intronic
1119667592 14:76496429-76496451 TGGGGCCATCAGCTCCAGGCAGG + Intronic
1119700355 14:76750538-76750560 GGGGGGGGTCAGCACCAGCCAGG + Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1122031573 14:98916143-98916165 TGGGGGACTCAGCACAAGGGAGG - Intergenic
1122546250 14:102524352-102524374 CTGGGGGGTCAGCCCCAGGCAGG + Intergenic
1126398252 15:48242320-48242342 CAGGGAAAACAGCTCCAGGCTGG + Intronic
1133087946 16:3379720-3379742 CAGAGGTATCAGCACCAGTCAGG - Intronic
1134016358 16:10891240-10891262 GGGGGGAAAGAGCACCAGCCTGG + Intronic
1138225979 16:55295005-55295027 TCAGTGAATCAGCACCAGGCAGG - Intergenic
1138294403 16:55874052-55874074 GGGAGGAATCAGGAGCAGGCTGG + Intronic
1141394337 16:83691462-83691484 CATGTGAAACAGCACCAGGCAGG - Intronic
1142359895 16:89621067-89621089 CGGGGGCCTCAGCTCCAGGCAGG + Intronic
1142780646 17:2178833-2178855 CGTGAGAATCCGCACCAGGGAGG - Intronic
1142995181 17:3755802-3755824 TGGCTGACTCAGCACCAGGCAGG - Intronic
1143284198 17:5777038-5777060 GAGGGGAAAGAGCACCAGGCTGG - Intronic
1144833340 17:18143794-18143816 CAGGTGGGTCAGCACCAGGCGGG + Exonic
1145965269 17:28912552-28912574 CGGGGGAGTGAGCACCCGGGTGG + Exonic
1147154305 17:38535844-38535866 GGGGAGAATCAGCACCTTGCCGG - Intronic
1147193314 17:38749221-38749243 TGCGGGAATCAGCGCCAGGCAGG - Intronic
1147536097 17:41324113-41324135 CCGAGGGATCAGCTCCAGGCTGG - Intergenic
1147995195 17:44356321-44356343 CAGGGGCATCAGCTCCAGCCAGG + Exonic
1149477855 17:56978124-56978146 CGGCAGCATCAGCAACAGGCTGG - Exonic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1151969199 17:77449270-77449292 TGGGGGATGCAGCCCCAGGCCGG + Intronic
1152694043 17:81734919-81734941 CAGGGGAAGCAGCTGCAGGCAGG + Intergenic
1160737687 19:671601-671623 AGGGGGAACCAGCCCCAGGCTGG + Intergenic
1161733532 19:5977149-5977171 TGGGGGAATCAGAGCCAGACAGG + Intronic
1162513182 19:11132075-11132097 CGGGAGGATGGGCACCAGGCTGG - Exonic
1162768159 19:12932823-12932845 CGTGGGATTCAGGACAAGGCAGG - Intronic
1163207671 19:15815492-15815514 CTGGGGAACCAGCACCTGCCAGG - Intergenic
1163587855 19:18173645-18173667 CTGGGGACCCAGCACCTGGCAGG + Exonic
1167258239 19:48443477-48443499 CGGCGGCAGCAGCTCCAGGCTGG - Exonic
1167615599 19:50531187-50531209 CGGGGGAGTCAGCAGGAGCCTGG - Intronic
1168436866 19:56325087-56325109 TGGAGGATTCACCACCAGGCTGG - Intronic
925180045 2:1811673-1811695 CGGTGTAAACAGCAGCAGGCAGG - Intronic
925901000 2:8509337-8509359 TGGGGGAATCAGCATCTGGCTGG - Intergenic
927865288 2:26583969-26583991 TGGGGGACACAGCACCAGCCAGG + Intronic
932339112 2:70948697-70948719 TGGGGGCTTCAGCACTAGGCCGG - Intronic
932347242 2:71003761-71003783 TGGGGGAAGCTGCACCAGGAGGG - Intergenic
934615616 2:95768848-95768870 CGAGGGAATCTGCTCCATGCAGG - Intergenic
934645282 2:96055710-96055732 CGAGGGAATCTGCTCCATGCAGG + Intergenic
934838687 2:97611799-97611821 CGAGGGAATCTGCTCCATGCAGG + Intergenic
936679299 2:114752218-114752240 AGGGGGAACCAGCACATGGCAGG - Intronic
945365393 2:208946543-208946565 CTGAGGAATTAGCACCAAGCTGG + Intergenic
945485671 2:210392913-210392935 CTGGGGAATCTCCTCCAGGCAGG - Intergenic
946133076 2:217622529-217622551 TGGGGGAAACGGCAGCAGGCTGG + Intronic
946434923 2:219645018-219645040 CGGGGGAAATAGCGACAGGCCGG - Intergenic
948262998 2:236618020-236618042 CGAGGGACTCAGCTGCAGGCTGG + Intergenic
948701755 2:239765049-239765071 CGGGGGAATCAGCACCAGGCTGG - Intronic
948710407 2:239821709-239821731 TGGGAGCATCAGCCCCAGGCAGG + Intergenic
1172741378 20:37170376-37170398 CTGTGGAATCAGCTCAAGGCAGG + Intronic
1173720616 20:45254499-45254521 CAGGGCAAGCAGCACCAGGAAGG + Exonic
1174656757 20:52178107-52178129 CCGGGGAATCTGAACCAGCCAGG - Intronic
1176197384 20:63843750-63843772 CTGGGGAATCAGCCCTCGGCTGG - Intergenic
1176448107 21:6839824-6839846 CGCGGGAATCAGCACTGAGCCGG + Intergenic
1176826277 21:13704846-13704868 CGCGGGAATCAGCACTGAGCCGG + Intergenic
1178690087 21:34743314-34743336 CCGGCGAATCAGCACCTGCCTGG + Intergenic
1180244893 21:46540365-46540387 CCGGGCACTAAGCACCAGGCCGG - Intronic
1183662418 22:39229470-39229492 CGGGGGAACCAGGACCAGTGGGG - Intronic
1184106742 22:42371759-42371781 GGTGGGAATGAGGACCAGGCAGG - Intergenic
1184267520 22:43357105-43357127 CGGGGGAGTCAGGGCCAGCCAGG + Intergenic
1185137029 22:49079053-49079075 CCTGGGAAGAAGCACCAGGCCGG - Intergenic
949900499 3:8811097-8811119 CAGGGCAGTCAGCACCATGCTGG + Intronic
952241068 3:31532373-31532395 CGGGCGAATCGGCGCGAGGCCGG + Intergenic
952287232 3:31981005-31981027 CGGGGGAAGCCGCAGCAGCCCGG - Exonic
955327589 3:58021175-58021197 CTGGGCAAGAAGCACCAGGCCGG - Intronic
959902338 3:111674757-111674779 CGGGGGAGTGAGTAGCAGGCAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961461395 3:127052495-127052517 CAGGGGACTCCGCACCAGCCTGG + Intergenic
962930403 3:140030604-140030626 CTGAGGAAACAGCACCAGGGTGG + Intronic
967988844 3:195116189-195116211 CGGTGGAATCTGCACCATGCTGG + Intronic
975266159 4:72370273-72370295 TGGAGGATTCACCACCAGGCTGG - Intronic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
984828328 4:183948443-183948465 TTGGGGAATAATCACCAGGCAGG + Intronic
985833095 5:2250485-2250507 AGAGGGAACCAGCACCAGGACGG + Intergenic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
995127018 5:108588271-108588293 TGGTGGCATCAGCCCCAGGCAGG + Intergenic
998783968 5:145689168-145689190 CTGGGAAATAAGCACCAGCCAGG - Intronic
999330072 5:150667478-150667500 CAGAGGAATTGGCACCAGGCAGG - Intronic
1001031844 5:168268992-168269014 CGGGAGAATCTGCAACAGTCTGG + Intergenic
1002103166 5:176867344-176867366 GGGGGGACTCCGCTCCAGGCTGG - Intronic
1002135034 5:177102164-177102186 CTGGGGAGTCAGCACCTGGGAGG + Intergenic
1002823655 6:753325-753347 CAGGGGAGTGAGCACCAGGGTGG + Intergenic
1003199809 6:3948963-3948985 AGGGGGACTCAGGACCAGGTAGG + Intergenic
1004044338 6:12011503-12011525 CTGGGGAACCAGCACACGGCGGG - Intronic
1011064691 6:83312351-83312373 CTGAGGAATCACCACCAGGTGGG - Intronic
1011148585 6:84244699-84244721 GGGGGGAGTCAGCCCCCGGCCGG - Intergenic
1016339791 6:143049978-143050000 CGGGGGAGCCAGAAGCAGGCAGG - Intergenic
1017183246 6:151574318-151574340 GACGGGATTCAGCACCAGGCAGG - Intronic
1019129625 6:169864309-169864331 AGGGGGAAGGAGCACCAGGGAGG - Intergenic
1019648563 7:2143970-2143992 CAGGCAAAACAGCACCAGGCAGG + Intronic
1019828526 7:3302356-3302378 TGGGGGAGTCAGGAGCAGGCGGG - Intronic
1021876686 7:25056084-25056106 TGGTGGAAAGAGCACCAGGCAGG - Intergenic
1022848759 7:34238074-34238096 CGGGGGAAGAAGCTGCAGGCAGG - Intergenic
1023709905 7:42980861-42980883 CAGGGGCATGAGCACTAGGCTGG - Intergenic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1033245431 7:139713393-139713415 TAGGGGCACCAGCACCAGGCAGG + Intronic
1034546542 7:151793458-151793480 TGTGGGATCCAGCACCAGGCGGG + Intronic
1034831995 7:154316847-154316869 CGGGAGAAGGAGCACCAGCCTGG + Intronic
1034990437 7:155544602-155544624 AGTGGGAATCAGCTCCCGGCTGG + Intergenic
1035677959 8:1468272-1468294 CTGGGGACTCAGGACCAGCCCGG - Intergenic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1042506485 8:69566074-69566096 TGGTGGAATGAGCACCATGCTGG - Intronic
1044589071 8:93896257-93896279 AGAGGAAATCAGCTCCAGGCAGG - Intronic
1048938205 8:139374540-139374562 CGAGGGAAGCAGCACAGGGCAGG + Intergenic
1049569809 8:143364019-143364041 CGGTGGGCTCTGCACCAGGCTGG + Intergenic
1049664406 8:143836663-143836685 TCCGGGAATCAGCACCAGGTGGG + Intronic
1050277958 9:4019566-4019588 AGGGGAAATCAACAACAGGCAGG + Intronic
1060221053 9:121764292-121764314 TGGGGGCCTGAGCACCAGGCAGG + Intronic
1060313786 9:122489314-122489336 CGGAGGATTCACCACCAGACTGG + Intergenic
1061781624 9:132999654-132999676 GTGGGGAATCAGCCCCGGGCAGG + Intergenic
1203521083 Un_GL000213v1:44694-44716 CGCGGGAATCAGCACTGAGCCGG - Intergenic
1186188934 X:7050341-7050363 CAGGGAATTCAGCACCAGGGTGG + Exonic
1186461661 X:9753146-9753168 CGGGTGGATCAGGACCAGCCAGG + Intronic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1190522418 X:51294010-51294032 CTGGGGTATCAGCAACAGGGTGG + Intergenic
1192204688 X:69088222-69088244 CAGGGAAATCAGAACCAGGCTGG - Intergenic
1192822399 X:74658579-74658601 CGGGAGAAAGAGCACCAGGCGGG - Intergenic
1195294659 X:103464226-103464248 CAGGGGACTCAGCAGCGGGCAGG - Intergenic
1197998033 X:132401387-132401409 CTGGGAAATCAGTACCAGACTGG + Intronic
1199489252 X:148380490-148380512 CAGGGGAGTCAGCACCAAGAAGG + Intergenic
1201764383 Y:17564860-17564882 CGAGGGAAAAAGCAGCAGGCCGG - Intergenic
1201837170 Y:18341130-18341152 CGAGGGAAAAAGCAGCAGGCCGG + Intergenic