ID: 948704457

View in Genome Browser
Species Human (GRCh38)
Location 2:239780231-239780253
Sequence CACACTGGTGATGGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 471}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948704445_948704457 4 Left 948704445 2:239780204-239780226 CCCCTGAAAGGTGGTGGGTTCTG 0: 1
1: 0
2: 0
3: 19
4: 159
Right 948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG 0: 1
1: 0
2: 3
3: 53
4: 471
948704441_948704457 14 Left 948704441 2:239780194-239780216 CCTGCAAAGACCCCTGAAAGGTG 0: 1
1: 0
2: 4
3: 10
4: 139
Right 948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG 0: 1
1: 0
2: 3
3: 53
4: 471
948704439_948704457 20 Left 948704439 2:239780188-239780210 CCAGTGCCTGCAAAGACCCCTGA 0: 1
1: 0
2: 8
3: 131
4: 370
Right 948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG 0: 1
1: 0
2: 3
3: 53
4: 471
948704446_948704457 3 Left 948704446 2:239780205-239780227 CCCTGAAAGGTGGTGGGTTCTGA 0: 1
1: 0
2: 0
3: 23
4: 154
Right 948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG 0: 1
1: 0
2: 3
3: 53
4: 471
948704447_948704457 2 Left 948704447 2:239780206-239780228 CCTGAAAGGTGGTGGGTTCTGAG 0: 1
1: 0
2: 0
3: 14
4: 209
Right 948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG 0: 1
1: 0
2: 3
3: 53
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948704457 Original CRISPR CACACTGGTGATGGGGAAGG GGG Intronic
900463070 1:2810594-2810616 GACCCTGGTGCTGGGGAGGGTGG - Intergenic
900513098 1:3069539-3069561 GACACTGGTGGGGGGGGAGGGGG - Intronic
900687621 1:3958674-3958696 CACCCTGGGGCTGGGGAGGGAGG - Intergenic
900820645 1:4884776-4884798 CCCTACGGTGATGGGGAAGGTGG + Intergenic
901238176 1:7678636-7678658 TACACTGGGGATGCGGTAGGAGG + Intronic
901825398 1:11858168-11858190 CACACTGGAATGGGGGAAGGCGG + Intronic
902391213 1:16108085-16108107 CACACTGATGATGAGGAGGAAGG - Intergenic
902411255 1:16212733-16212755 CAAACCGGTTCTGGGGAAGGGGG - Intergenic
902542745 1:17166231-17166253 CAAACTGATGGTGGGGATGGTGG - Intergenic
902637593 1:17744768-17744790 GAGGCTGGTGATGGGGAAGCTGG + Intergenic
902965496 1:19998119-19998141 CACACTGATGATGCGGAGGAAGG + Intergenic
904404364 1:30276251-30276273 CTCACTGACAATGGGGAAGGTGG - Intergenic
905029756 1:34874100-34874122 CATTCTGGTGATCGGGAAGGAGG - Intronic
905923165 1:41732467-41732489 CACACAGGTGCTAGGGAAGGTGG + Intronic
907246690 1:53113582-53113604 GGCCCTGGGGATGGGGAAGGGGG - Intronic
907740781 1:57163558-57163580 CACGCTGGTGGTGGGGGCGGCGG + Intronic
908519886 1:64931449-64931471 CACCCTGTTGCTGGGGGAGGTGG - Intronic
909490417 1:76219974-76219996 CACAGTGGTGAATGAGAAGGAGG + Intronic
912513000 1:110201225-110201247 CACAGTGGGGAGGGGGCAGGCGG - Exonic
913353487 1:117890169-117890191 GGGACTGGTGGTGGGGAAGGAGG + Intronic
914048613 1:144113269-144113291 CACACTGGGGCCGGGCAAGGTGG + Intergenic
914086704 1:144460942-144460964 CAGGCTGGTGATGGGCAAGCCGG - Intronic
914130571 1:144852179-144852201 CACACTGGGGCCGGGCAAGGTGG - Intergenic
914192598 1:145424879-145424901 CAGGCTGGTGATGGGCAAGCCGG - Intergenic
914590511 1:149102828-149102850 CAGGCTGGTGATGGGCAAGCCGG - Intronic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
914899042 1:151702334-151702356 CACACTGGGAAGGGGGAGGGAGG - Intergenic
914983428 1:152436478-152436500 CACACTGTTGATGGGTAGGGTGG - Intergenic
915168375 1:153961421-153961443 CACAATGGGGAGGGGGATGGAGG - Intronic
915168468 1:153962025-153962047 CACACAGGGAATGGGGAAGGGGG + Intronic
915179757 1:154048048-154048070 CACACTGATGATGTGGAGGAAGG + Intronic
915447361 1:155981597-155981619 CAACCTGGTGAAGGGGAATGAGG - Intronic
916259083 1:162822680-162822702 CACGCTGATGATGAGGAAGGTGG + Intergenic
916491958 1:165309720-165309742 CACAAAGTTCATGGGGAAGGTGG - Intronic
917380537 1:174401412-174401434 CTCACCCGTGATGGGGAATGAGG + Intronic
918238833 1:182604221-182604243 CAGGCAGGTGGTGGGGAAGGCGG + Exonic
919465211 1:197917212-197917234 CCCCCTGGTGATGGGCAAGCAGG - Intronic
919730534 1:200911384-200911406 CACACTGGGGTTGGGGCGGGAGG - Intronic
920371043 1:205479535-205479557 GACCATGGTGATGGGGAGGGGGG + Intergenic
920427711 1:205891393-205891415 CACACTGATGATGAGGAAGAAGG + Intergenic
920583733 1:207137460-207137482 CAAAGTGGTGTCGGGGAAGGAGG + Intronic
920681040 1:208072963-208072985 CACCATGGTGAGGGGGATGGAGG - Intronic
921000143 1:211035896-211035918 CACACTTCTGAGGAGGAAGGTGG - Intronic
922739943 1:228009107-228009129 CAAAGTGGTGGTGGGGATGGGGG - Intronic
922956720 1:229608678-229608700 CATACTAGTGGTGGGGAAGCTGG + Intronic
924765152 1:247025345-247025367 CACACTGATGATGAGGAGGAAGG + Intergenic
1062931343 10:1354654-1354676 CATCCTTGGGATGGGGAAGGTGG + Intronic
1063817423 10:9791638-9791660 CAAACTGGTGCTGGGCATGGTGG - Intergenic
1064002530 10:11675360-11675382 CACAGGGGTGGTGAGGAAGGAGG + Intergenic
1065839281 10:29687563-29687585 CACACTTGTGCTGAGGCAGGAGG + Intronic
1066281504 10:33922573-33922595 CACAGTGGTGAAGGGGAGGTGGG + Intergenic
1066644897 10:37596442-37596464 CACACTGGTGAGATGGAATGTGG - Intergenic
1067450860 10:46381080-46381102 CACACTGGTGAGGGCGGAGGAGG - Exonic
1067586383 10:47478671-47478693 CACACTGGTGAGGGCGGAGGAGG + Exonic
1067907106 10:50304091-50304113 CACAGTATTGATGGGGGAGGGGG + Intergenic
1068166675 10:53340295-53340317 CACACTGATGATGAGGAGGAAGG - Intergenic
1070199839 10:74193403-74193425 CACACTGGGGTGGGGGGAGGCGG - Intronic
1070402824 10:76068414-76068436 CAGACTGGGGGTGGGGATGGGGG + Intronic
1070908276 10:80094037-80094059 CTCAGGGGTGATGGGGGAGGTGG - Intergenic
1071325746 10:84515390-84515412 GAGACTGGAGATGGGGGAGGGGG - Exonic
1071501651 10:86208342-86208364 CAGACTGGAGCTGGGGTAGGAGG - Intronic
1072564551 10:96606629-96606651 CACACTTGCCAGGGGGAAGGGGG + Intronic
1073213869 10:101826058-101826080 CAGTCTTCTGATGGGGAAGGGGG + Intronic
1073250065 10:102115594-102115616 TTCAGTGGTGGTGGGGAAGGGGG - Intronic
1073517331 10:104088315-104088337 CACACAGGTGAAGGGCAGGGTGG + Intergenic
1074450415 10:113554942-113554964 CAGACAGGTGGTCGGGAAGGCGG + Intronic
1074638009 10:115344038-115344060 CATACTGGTGATGGCCACGGTGG - Intronic
1074936020 10:118182293-118182315 CACACAGGTGATTGGGGAAGGGG - Intergenic
1074980383 10:118615015-118615037 CACACTGCTGATGAGGAGGAAGG - Intergenic
1075069784 10:119313268-119313290 AATAGTGGTGATGGGGATGGTGG + Intronic
1076720924 10:132392638-132392660 GACAATGGTGATGGTGATGGTGG + Intergenic
1076933931 10:133555189-133555211 CAAGGTGGTGATGGGGCAGGAGG - Intronic
1077061864 11:621064-621086 CATACTGGTAATGGGGAGGGAGG - Exonic
1077249302 11:1554004-1554026 CAGACTGGTGGTGGGCAGGGTGG - Intergenic
1077282656 11:1752695-1752717 CCAACTTGGGATGGGGAAGGAGG - Intronic
1077463482 11:2722462-2722484 CACAAAGGAGATCGGGAAGGTGG + Intronic
1077522329 11:3043676-3043698 CACACTGATCACGGGGAAGTTGG + Intronic
1077546670 11:3174163-3174185 AACAATGGTGATGGTGATGGTGG - Intergenic
1077874298 11:6291016-6291038 CCCACTGGTGTTGGGGAAGAAGG + Intergenic
1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG + Intronic
1078501085 11:11877231-11877253 CAAACTGGAGAGGGGAAAGGAGG + Intronic
1079035543 11:17016203-17016225 GACAGTGGTGTTGGGGAAGGAGG + Intergenic
1079154022 11:17927234-17927256 CACACTGGACAAGGGGAAGTGGG - Intronic
1079451129 11:20600762-20600784 TACAGTGGTGATGGGGATGCGGG + Intronic
1080719224 11:34832863-34832885 CAAACTGTTGATGGTGAAGAAGG - Intergenic
1080789239 11:35506626-35506648 CACTCAGGTCATGGGGGAGGAGG - Intronic
1081553517 11:44136230-44136252 TACACTGGGGGTGGGAAAGGAGG - Intronic
1081616245 11:44593089-44593111 ACCTCCGGTGATGGGGAAGGTGG - Intronic
1083297947 11:61725338-61725360 CCCACTGGGGATGGGGTTGGGGG + Intronic
1083607734 11:63988782-63988804 CACCCTGGGGGTGGGGCAGGAGG + Intronic
1083766834 11:64845265-64845287 CACACTGAGGCTTGGGAAGGAGG + Intergenic
1083889086 11:65586966-65586988 CACAATGGGCATGGGGGAGGGGG - Intronic
1084113083 11:67025838-67025860 CTTACGGGTGATGGGGAAGACGG + Intronic
1084444317 11:69194715-69194737 GATACTGGTGATGGTGATGGTGG + Intergenic
1084444328 11:69194782-69194804 GATACTGGTGATGGTGATGGTGG + Intergenic
1085256229 11:75175116-75175138 CACACTGGGGATGGGGAGTGGGG + Intronic
1085319511 11:75565329-75565351 GCTGCTGGTGATGGGGAAGGGGG + Intronic
1085535316 11:77213915-77213937 CCCAATGGTGATGTGGAAGTAGG - Exonic
1086581926 11:88409205-88409227 CACCATGGTGAAGGTGAAGGTGG - Intergenic
1089104398 11:115990157-115990179 CTCGCTGGGCATGGGGAAGGCGG - Intergenic
1089340548 11:117754486-117754508 CACAGGGGTGATGGGGGAGCGGG + Intronic
1089378697 11:118012680-118012702 CAGATTGGGGATGGGGCAGGGGG + Intergenic
1089672656 11:120067322-120067344 CACACAGGAGGTGGGGCAGGGGG - Intergenic
1089752516 11:120661433-120661455 CACACTGGGGGTGGGGTTGGGGG + Intronic
1090232407 11:125117819-125117841 CCCTCTGGTGTTGGAGAAGGGGG + Intergenic
1090416260 11:126542626-126542648 AAGACAGGAGATGGGGAAGGTGG - Intronic
1090917798 11:131181351-131181373 GACAATGGTGGTGGGGAAGAGGG + Intergenic
1091912730 12:4244935-4244957 CAGCGGGGTGATGGGGAAGGAGG - Intergenic
1092116491 12:6012416-6012438 CACGCCAGGGATGGGGAAGGTGG + Intronic
1092373216 12:7934332-7934354 CCCACTGGTGGTGGTGGAGGGGG + Intronic
1092569107 12:9702424-9702446 CACTCTGGTGATGGGGCCTGTGG + Intergenic
1093518406 12:20018748-20018770 CACACTGGGGATGGGGACGGTGG + Intergenic
1094201877 12:27803413-27803435 CACACTGATGGAGGAGAAGGAGG + Intergenic
1095806700 12:46327496-46327518 AACATTGGAGATGTGGAAGGGGG - Intergenic
1097043423 12:56170081-56170103 CACTGTGGTGATGGGGAAGTTGG - Intronic
1097364695 12:58699463-58699485 CACACTCTTGATAGTGAAGGGGG - Intronic
1098199163 12:68036502-68036524 GACACTGGTTATGGAGGAGGTGG + Intergenic
1098745396 12:74231596-74231618 CAAAGTGGTGATGAGAAAGGAGG + Intergenic
1100316466 12:93449174-93449196 CAGACAGGTGATGGTGAAGGAGG - Intergenic
1101025284 12:100597765-100597787 CAAACTGGTGGCGGGGAATGGGG - Intronic
1101872675 12:108578819-108578841 CACAATGATGATGGTGATGGTGG - Intergenic
1102000715 12:109556517-109556539 CACATTTGTAAAGGGGAAGGCGG - Exonic
1102407466 12:112686271-112686293 CACACATGTGATAGAGAAGGGGG - Intronic
1103477892 12:121232185-121232207 GACACTGGTGCTGGAGGAGGAGG + Intronic
1105029208 12:132871126-132871148 CACAGTGGTGAGGGAGAATGGGG - Intronic
1105710753 13:23006801-23006823 CACACTGATGATGAGGAGGAAGG + Intergenic
1106029522 13:25987567-25987589 CACAGTGGTGACGGGGAGTGAGG - Intronic
1107266653 13:38563467-38563489 CAGAAGTGTGATGGGGAAGGGGG + Intergenic
1107387540 13:39928301-39928323 CACACTGGTGGTGGGGATGGTGG + Intergenic
1108323205 13:49306151-49306173 CACAGTGGTGAAGCTGAAGGGGG - Intergenic
1108865671 13:54919676-54919698 CACACTGATGATGAGGAGGAAGG - Intergenic
1109801869 13:67390580-67390602 CCCACTGGGGAAGGGGAAAGGGG - Intergenic
1110545650 13:76752389-76752411 CACAGTGGTCTTGGGGAGGGAGG - Intergenic
1111835621 13:93385263-93385285 ACCACTGGAGAAGGGGAAGGAGG + Intronic
1112370468 13:98788767-98788789 CTCACTGGGGAGGGGGAATGGGG - Intergenic
1113264188 13:108598999-108599021 CACTCTGGGGATGGGGTGGGGGG - Intronic
1113745399 13:112741243-112741265 CACACTGGGGGTGGAGAAGGTGG + Intronic
1113745423 13:112741320-112741342 CACACCAGGGATGGAGAAGGTGG + Intronic
1117600238 14:57366666-57366688 CACACTGATGATGAGGAGGAAGG + Intergenic
1117630125 14:57682477-57682499 CACACCTGTCATGGGGTAGGGGG + Intronic
1117899009 14:60514578-60514600 CAAACTGGCGAAGGGAAAGGAGG - Intronic
1117937940 14:60928029-60928051 AAGTCTGGTGATGGGAAAGGGGG - Intronic
1118050058 14:62016906-62016928 CACACTGGTGATGGGATACAGGG - Intronic
1118346712 14:64946383-64946405 CACACTGGGGCTAGGGAAGTAGG - Exonic
1119908565 14:78328114-78328136 CACACAGGGGATGGGGTGGGTGG + Intronic
1121015602 14:90547043-90547065 AACACCAGTGCTGGGGAAGGTGG - Intronic
1121325430 14:93016916-93016938 CACTCTGGAGATGGGGCAGGAGG + Intronic
1121334546 14:93069414-93069436 CACACAGCAGCTGGGGAAGGGGG - Intronic
1121751750 14:96363412-96363434 CACACTGGGGCCGCGGAAGGCGG + Exonic
1122577547 14:102751567-102751589 CACCCTGGTGCTGCGGGAGGCGG + Intergenic
1122652777 14:103234707-103234729 CACACTGGTAATGAGGAGGAAGG + Intergenic
1202843826 14_GL000009v2_random:148705-148727 CACACTGATGATGAGGAGGAAGG - Intergenic
1202913228 14_GL000194v1_random:138949-138971 CACACTGATGATGAGGAGGAAGG - Intergenic
1202879424 14_KI270722v1_random:43736-43758 CACACTGATGATGAGGAGGAAGG + Intergenic
1124127111 15:26945981-26946003 CTCAGTGATGGTGGGGAAGGCGG + Intronic
1124645177 15:31433506-31433528 CACACAGGGACTGGGGAAGGGGG - Intronic
1126681012 15:51202206-51202228 CACACTGATGCTGAGGTAGGTGG - Intergenic
1127285228 15:57526868-57526890 CACGCTGGGCATTGGGAAGGGGG + Intronic
1128281967 15:66403115-66403137 CACACTGCTGCAGTGGAAGGAGG + Intronic
1128836641 15:70814122-70814144 CACACACGTGAGAGGGAAGGGGG + Intergenic
1128849885 15:70943720-70943742 CACACTGGAGTTGGGCAAGTGGG - Intronic
1129109502 15:73329332-73329354 GACACTGGAGACGGGGAAGGTGG + Intronic
1129231113 15:74197662-74197684 CCCACTGGGGCTGGTGAAGGGGG - Intronic
1129510298 15:76116574-76116596 CACACTCATGATGGTCAAGGTGG - Intronic
1129724990 15:77897154-77897176 CCCACTGGTGGTGGCCAAGGGGG + Intergenic
1131820711 15:96271001-96271023 CACACTGCTGCTGGGCACGGTGG + Intergenic
1132018425 15:98339329-98339351 GACCCTGGCCATGGGGAAGGGGG - Intergenic
1132227046 15:100150799-100150821 GACACTGGGGCTGGGGAAGTGGG - Intronic
1132394095 15:101459591-101459613 CACAATGGTGATGGAGGAGGGGG - Intronic
1132732105 16:1367615-1367637 CAGACAGGTGAGGGGGAGGGAGG - Intronic
1133305085 16:4803569-4803591 CACACTGGGGGTGGGGGCGGGGG - Exonic
1134015179 16:10883211-10883233 GACCCTGGTGCTGGGGTAGGGGG - Intronic
1134425624 16:14141111-14141133 CACACCGGAGATGGAGAAAGTGG - Intronic
1134617345 16:15661761-15661783 ATCTCTGGTGATGGGGATGGTGG + Intronic
1136367027 16:29813616-29813638 CAGGCTGGTGATGGGGAAGAGGG + Exonic
1136716483 16:32287198-32287220 CACAGAGGAGATGGAGAAGGGGG - Intergenic
1136834869 16:33493476-33493498 CACAGAGGAGATGGAGAAGGGGG - Intergenic
1136913393 16:34161623-34161645 CTCATTCGTGATGGGGATGGGGG + Intergenic
1136982939 16:35074781-35074803 CACACTGATGATGAGGAGGAAGG - Intergenic
1137967533 16:52951638-52951660 AACATTGGTGGTGGAGAAGGAGG + Intergenic
1141035457 16:80621960-80621982 CTCACTGGTGTTGGGGAGGCTGG - Intronic
1141494010 16:84394363-84394385 CAGACTGGGACTGGGGAAGGGGG - Intronic
1141946754 16:87315931-87315953 CCCACGGGTGGTGGGGATGGGGG + Intronic
1142229300 16:88892243-88892265 CACACTGGTGCTGGGCCTGGTGG - Exonic
1142311204 16:89315035-89315057 CACACGGGTGATGTGGGTGGGGG - Intronic
1142349861 16:89575120-89575142 GGGACCGGTGATGGGGAAGGTGG + Intergenic
1203009934 16_KI270728v1_random:230556-230578 CACAGAGGAGATGGAGAAGGGGG + Intergenic
1203145035 16_KI270728v1_random:1793764-1793786 CACAGAGGAGATGGAGAAGGGGG - Intergenic
1142676109 17:1514384-1514406 CACACTCATGATGGGAAATGTGG + Intronic
1143296636 17:5876267-5876289 GACACTGGGGATGGGGAGGAGGG + Intronic
1143467258 17:7145838-7145860 GACAGTGGGGGTGGGGAAGGGGG - Intergenic
1144815155 17:18028952-18028974 GGCACTGGTGGTGGGGAGGGTGG - Intronic
1144821961 17:18081417-18081439 CACAAAGGTGGTGGTGAAGGAGG + Intergenic
1144872785 17:18381085-18381107 CCCCCTGGTGATGGTGAAGATGG + Intronic
1145737620 17:27244185-27244207 CCCCTTGGTGGTGGGGAAGGCGG - Intergenic
1146601162 17:34217783-34217805 CACTCTGATGATAGGGAAGCTGG + Intergenic
1146640906 17:34540684-34540706 CAAAATGGTGATAGGGAAGCTGG - Intergenic
1147459258 17:40557954-40557976 GGGAGTGGTGATGGGGAAGGGGG + Intronic
1147677918 17:42220071-42220093 CACACGGGTGCTGGGGCAGCTGG + Intronic
1147688130 17:42299501-42299523 CACACGGGTGCTGGGGCAGCTGG - Intronic
1148070957 17:44908231-44908253 CATACTCATGATGGGGAGGGGGG - Intronic
1148552022 17:48556066-48556088 GATGGTGGTGATGGGGAAGGGGG + Intronic
1149598079 17:57875690-57875712 CAGACTGGGGGAGGGGAAGGAGG + Intronic
1149813233 17:59698133-59698155 TACACTGGTGGTGGGCAAGAGGG - Exonic
1150604681 17:66680784-66680806 CACATTGGGGGTGGGGGAGGTGG + Intronic
1150781722 17:68128676-68128698 CACACTGAGGATGAGGAGGGAGG - Intergenic
1151544639 17:74785351-74785373 CACACTGTAGACAGGGAAGGAGG - Intronic
1152273379 17:79338932-79338954 CCCACTAGTGAGAGGGAAGGAGG + Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1153453754 18:5258845-5258867 CACACTGCTGCTGGGGGATGGGG - Intergenic
1155165695 18:23230761-23230783 AATACTGGAGATGGGGAGGGAGG - Intronic
1156593601 18:38520079-38520101 CACAGTGGTGCTGGGGATCGTGG + Intergenic
1157070305 18:44399875-44399897 AACACTGGTGATGAGGGATGAGG - Intergenic
1157293702 18:46427140-46427162 CACTCTGGGGATGGAGATGGTGG + Intronic
1157741409 18:50096649-50096671 CAGACTGGTGCTGGGGCAAGTGG - Intronic
1158622974 18:59048487-59048509 CACAAAGGTCCTGGGGAAGGAGG + Intergenic
1158721955 18:59933013-59933035 CCCACTGGGGATGGGGACTGGGG - Intergenic
1158735629 18:60075675-60075697 GGCACTGGAGATGGGGAGGGAGG - Intergenic
1159255641 18:65941840-65941862 AGCACTGGTGATGGTGGAGGAGG - Intergenic
1159424904 18:68272518-68272540 CACTCTTGGGAGGGGGAAGGGGG - Intergenic
1160362521 18:78296113-78296135 CACACTGGCGACGGGGAAGATGG - Intergenic
1161143823 19:2665115-2665137 CACACTCCTGATGGGGCAGACGG - Intronic
1161206930 19:3046437-3046459 CGGGCTGGGGATGGGGAAGGGGG + Intronic
1161249913 19:3275149-3275171 CTCCCTGGTAATGGGGAACGTGG - Intronic
1161513540 19:4684415-4684437 GACACTGGTGATGACGACGGTGG - Intronic
1161755538 19:6130921-6130943 TACACTGGAAATGGGGAAGGGGG - Intronic
1162252166 19:9454818-9454840 CACACTGATGATGAGGAGGAAGG + Intergenic
1162718264 19:12647303-12647325 CAGGCGGGTGATGGTGAAGGTGG + Exonic
1163843851 19:19627966-19627988 CAGACTGGGGAAGGGGTAGGGGG + Exonic
1164262048 19:23576591-23576613 CACACTGATGATGAGGAGGAAGG - Intronic
1165101577 19:33441549-33441571 TACCCTGGTGGTGGGGAAGGAGG - Intronic
1165355134 19:35299794-35299816 CAGGGTGGTGTTGGGGAAGGAGG - Exonic
1165782627 19:38442891-38442913 CACGCTTGGGATGGGGGAGGTGG - Intronic
1167559015 19:50214339-50214361 CCAACTGATGATGGGGATGGTGG + Intronic
1167622443 19:50567485-50567507 CACGCCAGTGATGGGGAGGGGGG - Intronic
1168276170 19:55279886-55279908 CGCAGTGGAGATGGGGAAGGGGG - Intronic
1202688066 1_KI270712v1_random:66172-66194 CACACTGGGGCCGGGCAAGGTGG + Intergenic
924988146 2:288984-289006 GAGACGGGAGATGGGGAAGGTGG - Intergenic
925006670 2:448414-448436 CCCACTGGTATTGGTGAAGGAGG - Intergenic
925154447 2:1638977-1638999 CACTGTGGTGAGGGGAAAGGAGG + Exonic
926223084 2:10948932-10948954 CACACTGGGGCTGGGGTAGATGG + Intergenic
927117929 2:19923455-19923477 CACACTGATGATGAGGAGGAAGG + Intronic
927420804 2:22928476-22928498 CACACTGGTGAGCAGGAAGGAGG - Intergenic
927879519 2:26680886-26680908 CACACAGTAGATGGGGAAGATGG - Intergenic
927897185 2:26790667-26790689 CCAACTGGTGGTGGGGAGGGAGG + Intronic
927993546 2:27465578-27465600 AAGACTGGTGATGGGGCAAGGGG + Intronic
928727801 2:34195349-34195371 GACAATAGTGATGGAGAAGGAGG + Intergenic
929747840 2:44677433-44677455 CAGACTGCTGATGAGGAAGTTGG - Intronic
930183186 2:48385236-48385258 CACACTGATGATGAGGAGGAAGG + Intergenic
930476452 2:51888508-51888530 CACCCTGGGGGAGGGGAAGGGGG - Intergenic
930721399 2:54641677-54641699 CACACAGGGAATGGGGCAGGGGG - Intronic
931625070 2:64250062-64250084 CTCACTGGTGCTAGGGATGGGGG + Intergenic
932518106 2:72374551-72374573 CACAGTGTTGAGAGGGAAGGTGG + Intronic
933958288 2:87389422-87389444 CACACTGGGGCCGGGCAAGGTGG - Intergenic
934032785 2:88063259-88063281 CAGACTGTTGGTGGGGAAGGGGG - Intergenic
934242414 2:90281339-90281361 CACACTGGGGCCGGGCAAGGTGG - Intergenic
934270760 2:91535344-91535366 CACACTGGGGCCGGGCAAGGTGG + Intergenic
935026027 2:99277874-99277896 CACACTGATGATGAGGAGGAAGG - Intronic
936154582 2:110039827-110039849 GCCACTGGGGATGGGGCAGGGGG + Intergenic
936190101 2:110331587-110331609 GCCACTGGGGATGGGGCAGGGGG - Intergenic
936377436 2:111954019-111954041 CACTATGGTGGTGGGGTAGGGGG - Intronic
936462186 2:112722088-112722110 CACACACCTGGTGGGGAAGGTGG - Exonic
937322375 2:120968660-120968682 ATCACTGGGGATGGGGGAGGGGG - Intronic
937366297 2:121264390-121264412 CAGAGTGGAAATGGGGAAGGCGG + Intronic
938364609 2:130725230-130725252 GACAATGGTGATGGTGATGGTGG + Intergenic
938500930 2:131831079-131831101 CCCACTGGGGGTGGGCAAGGCGG + Intergenic
939172226 2:138709473-138709495 CACACTGGTGGGGGGAAAGGTGG - Intronic
939766949 2:146262651-146262673 CTGAATGGTGAAGGGGAAGGGGG + Intergenic
941096754 2:161245791-161245813 CAAACAAGTGATGGGGCAGGGGG - Intergenic
941320025 2:164042333-164042355 CATACTGGTGAGAGGCAAGGAGG + Intergenic
941371853 2:164675210-164675232 CAGACTGATGGTTGGGAAGGAGG + Intronic
941415199 2:165212125-165212147 ATCACTGGTGATGGGAGAGGGGG - Intergenic
942014437 2:171796901-171796923 TAAACTGGGGATAGGGAAGGGGG + Intronic
942264705 2:174211021-174211043 CACACTCCTGAGGTGGAAGGAGG + Intronic
943062477 2:183053035-183053057 CACACTGATGATGAGGAGGAAGG - Intergenic
943930415 2:193843939-193843961 CACACTGAGGAAGTGGAAGGAGG + Intergenic
944668526 2:201976230-201976252 CACACAGAGGATGGGGAGGGAGG + Intergenic
945974433 2:216259413-216259435 CACAGTGGTGATGGGACAGAGGG + Exonic
946206545 2:218112962-218112984 CACACTGATGATGAGGAGGAAGG + Intergenic
946306160 2:218858222-218858244 CACACTAAAGAAGGGGAAGGGGG - Intergenic
946352110 2:219162003-219162025 GACCCTGGGGATGAGGAAGGAGG - Exonic
946482377 2:220069476-220069498 CACATTGGTGATGGGGGTGGAGG + Intergenic
946919696 2:224566069-224566091 CAGCCTGTAGATGGGGAAGGTGG - Intronic
947078543 2:226370056-226370078 CTCACTGATGCTGGGGAAGGTGG + Intergenic
947079660 2:226381919-226381941 AACGCTGGGGATGGCGAAGGAGG - Intergenic
947593424 2:231397105-231397127 CAGACTGGAGAAGGGGGAGGAGG + Intronic
947820778 2:233067996-233068018 CATGCTGGTGCTGGGCAAGGTGG + Intronic
948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG + Intronic
948993260 2:241565066-241565088 CACACAGCTGACGGGGAATGTGG + Intronic
1169403534 20:5303941-5303963 CACACTGATGATGAGGAGGAAGG + Intronic
1170205182 20:13790450-13790472 CAGCACGGTGATGGGGAAGGTGG - Intronic
1171026656 20:21636919-21636941 CACACAGGTGTGGGGGGAGGGGG + Intergenic
1171340631 20:24424683-24424705 CACATTTGTTGTGGGGAAGGAGG - Intergenic
1171385751 20:24768393-24768415 CACATTGTTGAGTGGGAAGGGGG - Intergenic
1173183316 20:40820772-40820794 CACAGTGGTCATGGGGGAGCAGG - Intergenic
1173748087 20:45453386-45453408 CTCACTGGGGATGGGGAGAGAGG + Intergenic
1174205036 20:48831987-48832009 CGGACGGGTGATGGGGAAGAAGG - Intergenic
1174254323 20:49243057-49243079 AAAACTGGAAATGGGGAAGGAGG - Intronic
1174377127 20:50133526-50133548 CCCATTTGTGATGGGGAGGGTGG + Intronic
1176026348 20:62987524-62987546 CACAGGGGGGATGGGGATGGGGG + Intergenic
1176632578 21:9153619-9153641 CACACTGATGATGAGGAGGAAGG - Intergenic
1177499764 21:21938567-21938589 CACAATTGTGATGCAGAAGGTGG - Intergenic
1177910052 21:27019815-27019837 AACAGTCGGGATGGGGAAGGAGG - Intergenic
1178264046 21:31125860-31125882 AACACTGGTGCTGGGCATGGTGG - Intronic
1178352457 21:31882066-31882088 CTCACGAGTGATGGGGGAGGGGG - Intronic
1178761865 21:35410975-35410997 GCCACTGGTGGTGGGGCAGGGGG + Intronic
1180342826 22:11631136-11631158 CCCATTCGTGATGGGGATGGGGG + Intergenic
1180567909 22:16690902-16690924 CACGCCAGGGATGGGGAAGGTGG + Intergenic
1180741521 22:18056267-18056289 CAGTCTGGTGCTGAGGAAGGGGG + Intergenic
1181350657 22:22255595-22255617 CACACTGGGGCCGGGCAAGGTGG + Intergenic
1181473049 22:23152553-23152575 CAACCTGGTGCTGGGGGAGGTGG - Intronic
1182244397 22:28944126-28944148 CACACTGCTGGTGGGGAGGGTGG + Intronic
1182492437 22:30682393-30682415 CTCACGGGTGAATGGGAAGGGGG + Intergenic
1183024287 22:35052430-35052452 CTGACTGGGGATGGGGATGGTGG - Intergenic
1183667182 22:39252898-39252920 CACACTGGTGGGTGGGATGGGGG - Intergenic
1183698287 22:39435659-39435681 CAGGGTGGTGGTGGGGAAGGGGG - Intronic
1184421991 22:44387387-44387409 CCCATTGGTGGTGGGGAGGGAGG - Intergenic
1184430784 22:44440622-44440644 AACAATGGTGCTGGGGAAGGCGG + Intergenic
949855384 3:8456681-8456703 CACTCTGATGCTGGAGAAGGAGG + Intergenic
949937181 3:9124944-9124966 GAGACTGGTGGTGGGGACGGGGG + Intronic
950334681 3:12183878-12183900 CACACTGGTGGAGGGAAAGTTGG - Intronic
951270677 3:20619758-20619780 CACACTGATGATGAGGAGGAAGG - Intergenic
953010832 3:39023971-39023993 AAAACTGGTGATTGGGAAGGGGG - Intergenic
953421057 3:42753605-42753627 TACACTGGAGCTGGGCAAGGGGG + Intronic
953779384 3:45853074-45853096 CACACTGAAGGTGGGGTAGGTGG + Intronic
954244053 3:49316869-49316891 CACACAGGCTATGGGGAGGGTGG - Intronic
954332763 3:49899606-49899628 CACACTGTTGCTGGGGCTGGAGG + Intronic
954642208 3:52107457-52107479 CACACAGGTGTTGGGCAGGGCGG - Intronic
954762930 3:52890112-52890134 CACACTGGAGAGGGGGAATGAGG - Intronic
954806708 3:53224840-53224862 CAAACTAGTGCTGGGGGAGGAGG - Intronic
955071108 3:55573088-55573110 AAGACTGTTGATGGGGAAGGAGG - Intronic
955101573 3:55854834-55854856 TAAACTGGGGATGGGGAAGGAGG + Intronic
955227508 3:57073209-57073231 CAAGCTTGGGATGGGGAAGGTGG + Intronic
957099432 3:75809415-75809437 CACACTGATGATGAGGAGGAAGG - Intergenic
958835961 3:99145381-99145403 AACACTGGAGATGGGAGAGGGGG - Intergenic
959927955 3:111945917-111945939 CAAAGTGGTGATGGGGACTGGGG - Intronic
960022844 3:112974967-112974989 CCCACTGTTGATGGGGTAAGAGG - Exonic
960028715 3:113036414-113036436 CACAGTAGTGATGGGGAAATTGG + Intergenic
961323225 3:126092805-126092827 CACACTGATGATGAGGAAGAAGG + Intronic
961452952 3:127010649-127010671 CACACTGGTGTTGGGGTGGGTGG + Intronic
961929679 3:130519774-130519796 GACAATGGTGATGGCGATGGTGG + Intergenic
962297304 3:134202630-134202652 CACAGTGGTGCAGGGAAAGGAGG - Intronic
963888173 3:150603719-150603741 AACAGTGGGAATGGGGAAGGAGG + Intronic
963995327 3:151701982-151702004 CACACTGTTGATGAGGAGGAAGG + Intergenic
965315307 3:167183204-167183226 CACACTGATGATGAGGAGGAAGG - Intergenic
965738475 3:171847777-171847799 CACGGTGGGGATGGGGGAGGAGG + Intronic
965848684 3:172994557-172994579 CACGCACGTGATGGGAAAGGAGG + Intronic
966642091 3:182203056-182203078 CACTCTGGTCATGGGGCAGAGGG + Intergenic
966689619 3:182729397-182729419 CATACTGGGGGTGGGGATGGAGG - Intergenic
966978299 3:185105909-185105931 CACACTGATGATGAGGAGGAAGG + Intronic
967138520 3:186532856-186532878 CACACTGGTGCTGGGGAAACAGG + Intergenic
967887122 3:194341034-194341056 CATACAGGAGCTGGGGAAGGGGG - Exonic
967913369 3:194559991-194560013 CCCACTGGTGCTATGGAAGGTGG - Intergenic
968470648 4:781008-781030 CACACGGGTCCTGGGGAGGGTGG + Intergenic
969109922 4:4838265-4838287 CACAGTTGTGAGGGGGAGGGTGG - Intergenic
970143139 4:13004658-13004680 TACACTGGTGATGCAGAAAGCGG + Intergenic
970778795 4:19710227-19710249 AGGATTGGTGATGGGGAAGGTGG - Intergenic
972133219 4:35862081-35862103 CACAGTGGTCATGGGCAAGGGGG + Intergenic
972289070 4:37674192-37674214 CAAACTTGTGATTGAGAAGGGGG - Intronic
973008430 4:45042759-45042781 CACACTGGTGATGAGGAGAAAGG + Intergenic
973231201 4:47840880-47840902 CACAGTAGTCATTGGGAAGGAGG + Intergenic
975352062 4:73357848-73357870 CACACTGATGATGAAGAAGAAGG + Intergenic
975406455 4:73996242-73996264 CACACTGGGGTTGGGGGTGGGGG - Exonic
976557020 4:86461610-86461632 CACACTGATGATGAGGAGGAAGG + Intronic
977641989 4:99367758-99367780 CACACTGATGATGAGGAGGAAGG + Intergenic
978566660 4:110089830-110089852 CACAATGGTGATGATGGAGGTGG + Intronic
979445877 4:120810376-120810398 CATAAGGGTGAGGGGGAAGGAGG + Intronic
979785760 4:124713043-124713065 CCCAGTGGTGACGGGGAGGGTGG - Intergenic
979893581 4:126131445-126131467 CACACTGATGATGAGGAGGAAGG + Intergenic
980667687 4:135960314-135960336 CACACTGATGATGAGGAGGAAGG - Intergenic
981313524 4:143319375-143319397 AACAGTGGTGATTGGGGAGGGGG - Intergenic
984488375 4:180401317-180401339 GACAGTGATGATGGGGAAGGGGG - Intergenic
985539888 5:482961-482983 CACACGGGTGCTGGGGGATGGGG + Intronic
985642360 5:1069576-1069598 CACACACATGAGGGGGAAGGAGG + Intronic
985674219 5:1221929-1221951 TACACTGGTGTCAGGGAAGGAGG + Exonic
985897566 5:2757949-2757971 CACACAGGTGTTGGGGAAGCGGG + Intergenic
986337743 5:6767734-6767756 CGCATTGGTGCTGGGGAACGAGG + Intergenic
988323988 5:29738055-29738077 CACACTGCTGCTGGTGGAGGTGG - Intergenic
989742479 5:44789286-44789308 CACACTGATGATGAGGAGGAAGG + Intergenic
990109405 5:52305199-52305221 CACACTGATGATGAGGAGGAAGG + Intergenic
990509128 5:56474499-56474521 CACAGGGGTGATGGGGTGGGAGG + Intronic
990744945 5:58950157-58950179 TACCCTGCTGATGGGGATGGTGG - Intergenic
991020874 5:61978730-61978752 CTAACTGGTTATGGTGAAGGTGG - Intergenic
991355273 5:65762576-65762598 CTCAGTGGTGTTGGGGAAGAGGG + Intronic
991649819 5:68840410-68840432 CACAAAGATGATGGGGACGGGGG + Intergenic
992416193 5:76553861-76553883 GACAGTGTTGGTGGGGAAGGGGG + Intronic
992958567 5:81936040-81936062 AACACGGGGGCTGGGGAAGGAGG + Intergenic
992966833 5:82011349-82011371 AAGAATGGTGATGGGCAAGGAGG - Intronic
993631061 5:90286592-90286614 TACACTGTTGATGAGGAAGTTGG - Intergenic
994818228 5:104612683-104612705 AGCACTAGTGATGGGGAAGATGG - Intergenic
995283807 5:110364316-110364338 CACACTGAGGATGGAGGAGGGGG - Intronic
995592339 5:113712629-113712651 CACACTGATGATGAGGAGGAAGG + Intergenic
996440694 5:123486964-123486986 CACACTGGAGGTGGGGAGTGTGG - Intergenic
997846760 5:137293571-137293593 CACACTGGGGAGGGGCAAGGTGG - Intronic
998023615 5:138793899-138793921 CCCTCAGGGGATGGGGAAGGGGG + Intronic
998036982 5:138925885-138925907 CACTCTGGCTATGGGGAAAGGGG - Intronic
998225181 5:140321479-140321501 CACACTGGAGAAGGAGAAGCTGG - Intergenic
999571983 5:152929180-152929202 TACACTTGTGAAGGAGAAGGAGG + Intergenic
1000001531 5:157143253-157143275 AAGAGTGGTAATGGGGAAGGGGG - Intronic
1001174026 5:169448219-169448241 CACACTGGGGAGGGAGAAGTGGG - Intergenic
1001879861 5:175234005-175234027 GCAACTGGTGATGAGGAAGGAGG + Intergenic
1002533874 5:179865479-179865501 CACCCTGGCGTTTGGGAAGGTGG + Intronic
1004667315 6:17760681-17760703 CCCACTGGGGAGGGGAAAGGAGG + Intronic
1005152730 6:22771459-22771481 CACACAGGTGATGTGGAATTTGG + Intergenic
1006038698 6:31235365-31235387 CACACTGATGATGAGGAGGAAGG - Intergenic
1006361242 6:33588595-33588617 CACTGTGCTGAGGGGGAAGGAGG + Intergenic
1006432414 6:34005791-34005813 CACACTGGTGCAGGGAGAGGGGG - Intergenic
1006445034 6:34075256-34075278 GTCACTGGAGTTGGGGAAGGTGG - Intronic
1007258823 6:40547714-40547736 CAGACTCGTGATGAGGAAGCTGG - Intronic
1007886537 6:45236430-45236452 CACACTGATGATGAGGAGGAAGG + Intronic
1008139632 6:47817185-47817207 CATACTGGAGATGAAGAAGGGGG + Intronic
1008366167 6:50683048-50683070 CAGAGTGGTGAGGGTGAAGGTGG - Intergenic
1009062939 6:58418981-58419003 CACACTGATGATGAGGAGGAAGG - Intergenic
1009250619 6:61293528-61293550 CACACTGATGATGAGGAGGAAGG - Intergenic
1009430802 6:63563692-63563714 CACATATGTGTTGGGGAAGGAGG + Intronic
1011385385 6:86791866-86791888 TACCCTGGTGATGGTGATGGGGG - Intergenic
1011763499 6:90593831-90593853 GACACTGGAAGTGGGGAAGGAGG + Intergenic
1011780110 6:90779290-90779312 CACACTAATTATGGAGAAGGAGG - Intergenic
1011822047 6:91264486-91264508 GACCCTTGTGATGGGGAGGGAGG - Intergenic
1017304343 6:152899071-152899093 CACGCTGTTGATGTTGAAGGTGG - Intergenic
1018110819 6:160535410-160535432 GACAGTGGTGATGGTGATGGTGG + Intronic
1018329735 6:162714366-162714388 GACACTGGTGACAGGGAGGGAGG + Intronic
1018442680 6:163827535-163827557 CCCATTTGTGAAGGGGAAGGAGG + Intergenic
1018627431 6:165792951-165792973 CACAGTGGTGCTGGGGTGGGGGG + Intronic
1018942350 6:168317970-168317992 CACACATGTGATGGGAAGGGAGG - Intronic
1019909039 7:4087435-4087457 CACATTGGTTATGGGGAAGCAGG - Intronic
1020565343 7:9787843-9787865 GACAGTGCTGATGGGGAATGTGG - Intergenic
1021389730 7:20077004-20077026 CAGACTTGTGCTGGGGATGGTGG - Intergenic
1021419756 7:20432612-20432634 CACAGTGGAGATGGAGAAGCAGG - Intergenic
1022882280 7:34600579-34600601 CACTCTGCTGATTGGGAAGATGG + Intergenic
1023558761 7:41450544-41450566 CACACTGGACAGGGTGAAGGCGG + Intergenic
1023856902 7:44189577-44189599 CACCATGGTGATGGGGATGGAGG - Intronic
1024507967 7:50179155-50179177 CACACAGCTGATGGTGAAGCCGG + Intergenic
1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG + Intronic
1025122572 7:56317641-56317663 CACACTGATGATGAGGAGGAAGG + Intergenic
1026366777 7:69656170-69656192 CACACTGGGGAAGGGGCAGAGGG - Intronic
1026603014 7:71792312-71792334 CATACTGGTGAGGGGGCTGGGGG - Intronic
1026618373 7:71928137-71928159 AAGATTGGTGATGGGGCAGGAGG - Intronic
1029112764 7:98222211-98222233 CACCCTGGTAATGGGGCAGCTGG - Intronic
1029548286 7:101222768-101222790 GACACTGGTGAGGCGGATGGAGG + Exonic
1030113888 7:106048986-106049008 TGCACTGGTGATGGGGATGTGGG - Intergenic
1033449224 7:141448051-141448073 CAGACTGGTTAGGGAGAAGGGGG - Intronic
1033451319 7:141464740-141464762 AACTGTGATGATGGGGAAGGAGG - Intronic
1034926263 7:155124885-155124907 CTCACTGGTGATGAGGAGAGTGG + Intergenic
1035064624 7:156095750-156095772 CACACCGGTCAGGAGGAAGGAGG + Intergenic
1035336051 7:158127532-158127554 CACAGTGCTGTTGGAGAAGGTGG - Intronic
1035536472 8:395066-395088 AGCACTGGTGAAGGGGAATGAGG + Intergenic
1036158746 8:6366958-6366980 CTGACTGGGGCTGGGGAAGGAGG - Intergenic
1036532125 8:9601400-9601422 AACAATGATGATGGGGAAAGAGG - Intronic
1036672965 8:10805521-10805543 CACACTAGTGCTGAGGGAGGAGG + Intronic
1036673112 8:10806202-10806224 CACACTAGTGCTGAGGGAGGAGG + Intronic
1037496269 8:19443873-19443895 CACACTGGGGGTGGGGGTGGAGG + Intronic
1037635344 8:20696946-20696968 CACACTGTTGATGGTGAATCAGG - Intergenic
1037753911 8:21699451-21699473 CTCCCTGGTGCTGGGAAAGGTGG + Intronic
1037846207 8:22284639-22284661 CACACCACTGATGGGGGAGGGGG - Intronic
1038238386 8:25784456-25784478 CATAGTGGTGATGGAGGAGGAGG - Intergenic
1038980695 8:32756279-32756301 TAGACTGGTGATGAGGAAGAGGG - Intronic
1039466775 8:37790192-37790214 GACAAAGGGGATGGGGAAGGAGG - Intronic
1039797868 8:40930809-40930831 AAGACTGCTGTTGGGGAAGGAGG - Intergenic
1040381471 8:46877241-46877263 CACACTGATGATGAGGAGGAAGG + Intergenic
1040528943 8:48249787-48249809 CACACTGATGATGAGGAGGAAGG - Intergenic
1041018838 8:53617775-53617797 CACACTGATGATGAGGAGGAAGG + Intergenic
1041146388 8:54880816-54880838 CACTCTGGTTGTGGGGAAGAGGG - Intergenic
1042446319 8:68889350-68889372 CACACTGATGATGAGGAGGAAGG + Intergenic
1043488654 8:80725026-80725048 CACTTTGGTGAAGGGGTAGGAGG - Intronic
1044303263 8:90609432-90609454 CTCACTGGTGATGGGTCTGGAGG + Intergenic
1044442355 8:92237251-92237273 CACACTGATGATGAGGAAGAAGG + Intergenic
1044606798 8:94054810-94054832 CACAGTGGTGCTCTGGAAGGGGG + Intergenic
1046549013 8:115688936-115688958 CAGAATGGTGAAGGGGAAGGAGG - Intronic
1049386053 8:142343735-142343757 GACAGTGGTGATGGGGAGTGGGG + Intronic
1049417570 8:142502299-142502321 GACAGTGGTGATGGTGATGGTGG + Intronic
1049674868 8:143884950-143884972 GACACTGGTGATGGAGATGGCGG - Intergenic
1049857461 8:144871753-144871775 CACACTGATGATGAGGAGGAAGG + Intergenic
1050878699 9:10673938-10673960 CAGCCTGGTGATGAGCAAGGTGG + Intergenic
1053001942 9:34581592-34581614 CATAGTGGTGATAAGGAAGGGGG - Intronic
1053126197 9:35582666-35582688 CACACTGATGATGAGGAGGAAGG + Intergenic
1054809893 9:69426354-69426376 CAGTCTGGGGATGGGGAAGTAGG + Intergenic
1055917159 9:81416131-81416153 CACACAGATGATGGTGGAGGGGG + Intergenic
1056144255 9:83713857-83713879 AACACTGGGGCAGGGGAAGGTGG + Intergenic
1056182984 9:84103438-84103460 GACACTGGGGAGGGGGAGGGAGG + Intergenic
1056403272 9:86248835-86248857 AACTGGGGTGATGGGGAAGGTGG - Intronic
1056587389 9:87937710-87937732 CACACTGGTGACTGGGTAGCAGG + Intergenic
1057286027 9:93755084-93755106 CACACTGATGATGAGGAGGAAGG - Intergenic
1059398481 9:114053857-114053879 CTCACTGGTGATGCGGCAGGTGG - Exonic
1059460281 9:114425214-114425236 CACACTGCTGATTGGGAGGCTGG - Intronic
1060155951 9:121319832-121319854 CACAGTGGAGAAGGGGAAGAGGG + Intronic
1060839270 9:126781394-126781416 CTCCCAGGTGATGGGGAAGGGGG + Intergenic
1061174770 9:128988039-128988061 CACCCTAGTGATGGGGCAGAGGG + Exonic
1061883686 9:133580227-133580249 CAGGCTGTTGATGGAGAAGGGGG - Exonic
1062049751 9:134441127-134441149 CACACTGAAGATGGGGAGTGGGG + Intergenic
1062172156 9:135140783-135140805 AAGACTGGTGCTGGTGAAGGGGG + Intergenic
1062216529 9:135392509-135392531 CCCACTGGTGCTGGGGCAGTGGG - Intergenic
1062572016 9:137190113-137190135 CACACAGGCTATGGGGATGGTGG + Exonic
1203687223 Un_GL000214v1:6515-6537 CACACTGATGATGAGGAGGAAGG + Intergenic
1203755410 Un_GL000218v1:121243-121265 CACACTGATGATGAGGAGGAAGG - Intergenic
1203360935 Un_KI270442v1:218711-218733 CCCATTCGTGATGGGGATGGGGG - Intergenic
1203714785 Un_KI270742v1:133783-133805 CACACTGATGATGAGGAGGAAGG - Intergenic
1203649052 Un_KI270751v1:97538-97560 CACACTGATGATGAGGAGGAAGG - Intergenic
1186899535 X:14038670-14038692 TATGCTGGTGGTGGGGAAGGAGG + Intergenic
1188705194 X:33319445-33319467 CACACTCATCATGGGGGAGGAGG - Intronic
1188887553 X:35569039-35569061 CAGACTGCTCCTGGGGAAGGAGG + Intergenic
1189508767 X:41639743-41639765 CTGACTGGGGATGGGGATGGGGG - Intronic
1189715855 X:43865401-43865423 GACGGTGGTGATGGGGAATGAGG + Intronic
1190093512 X:47460783-47460805 CATACTGCTGATGGAGGAGGTGG + Intronic
1190298193 X:49040748-49040770 CACAGTGGGGAAGGGAAAGGGGG - Intronic
1191024016 X:55894139-55894161 CACACTGGTGGTGGTGGTGGTGG - Intergenic
1191149740 X:57208326-57208348 CACACTAATGATGAGGAAGAAGG - Intergenic
1191580832 X:62758996-62759018 CACACTGGTGAGGAGGAGGAAGG - Intergenic
1192220804 X:69196189-69196211 CACAGTCTTGTTGGGGAAGGGGG + Intergenic
1192884645 X:75323900-75323922 CACACTAATGATGAGGAAGAAGG + Intergenic
1194536260 X:95108536-95108558 CACACTGATGATGAGGAGGAAGG - Intergenic
1195720546 X:107863582-107863604 CACACTGGAAATGGGGAATTTGG - Intronic
1196726622 X:118901392-118901414 AACACTGGTGATGGGTGTGGTGG - Intergenic
1196937617 X:120745268-120745290 CAGAAGGGTGATGGGGAAGCAGG - Intergenic
1197110755 X:122771524-122771546 CCCACTACTGCTGGGGAAGGTGG - Intergenic
1197147414 X:123185112-123185134 CAGGCTGGTGCTGGGGGAGGTGG + Intronic
1199193838 X:145003741-145003763 GACACTGAAGATGGAGAAGGAGG + Intergenic
1199714761 X:150499352-150499374 CACTCTGGTGATTCGGAAGGAGG - Intronic
1199757757 X:150881148-150881170 GACACTGGAGAGGAGGAAGGAGG - Intronic
1199972281 X:152870181-152870203 CCCTCTGCTGATGGGGCAGGGGG + Intergenic
1200978448 Y:9238761-9238783 CACACTGCTGATGAGGAGGAAGG + Intergenic
1201287420 Y:12391069-12391091 GAAAGTGGTGCTGGGGAAGGAGG + Intergenic
1201560410 Y:15310249-15310271 AACAGTGGTGATGGTGATGGTGG + Intergenic
1201575057 Y:15454639-15454661 CTCACTGGGCAGGGGGAAGGTGG + Intergenic
1202164108 Y:21968742-21968764 CACACTGATGATGGGGAGGAAGG - Intergenic
1202227248 Y:22617622-22617644 CACACTGATGATGGGGAGGAAGG + Intergenic
1202315874 Y:23578032-23578054 CACACTGATGATGGGGAGGAAGG - Intergenic
1202554891 Y:26092042-26092064 CACACTGATGATGGGGAGGAAGG + Intergenic