ID: 948705417

View in Genome Browser
Species Human (GRCh38)
Location 2:239789341-239789363
Sequence ATACTGACGGGTCTCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948705417_948705428 17 Left 948705417 2:239789341-239789363 CCCACAGGGAGACCCGTCAGTAT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 948705428 2:239789381-239789403 CCTGCCTCATTAGTCGTGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 55
948705417_948705426 16 Left 948705417 2:239789341-239789363 CCCACAGGGAGACCCGTCAGTAT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 948705426 2:239789380-239789402 TCCTGCCTCATTAGTCGTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948705417 Original CRISPR ATACTGACGGGTCTCCCTGT GGG (reversed) Intronic
900585195 1:3429261-3429283 AAACTGACTGTCCTCCCTGTTGG + Intronic
901119972 1:6883257-6883279 AAACAGACGGGTTTCACTGTGGG + Intronic
901724988 1:11234579-11234601 CTACTCACAGCTCTCCCTGTTGG - Intronic
905897014 1:41554871-41554893 ATACAGGCGGGTGTCCCTCTGGG - Intronic
911008530 1:93253553-93253575 ATAAGGACAGGTCTCCCTTTGGG + Intronic
923663489 1:235979029-235979051 ATACAGCCGGGTCTGCTTGTGGG + Exonic
1068878040 10:62018538-62018560 ATATTGCCCGGTCTCCATGTTGG + Intronic
1069370054 10:67738190-67738212 ATACAGGCGGGTGTCCCTCTGGG + Intergenic
1074718614 10:116244935-116244957 ATACTTTAGGGTTTCCCTGTTGG - Intronic
1080736708 11:35022728-35022750 ATACTGACAGGTGCCCCTCTGGG + Intergenic
1081652683 11:44834951-44834973 AAACTTACAGGTTTCCCTGTGGG - Intronic
1084660622 11:70544478-70544500 TGACTGACGGATCTCACTGTGGG + Intronic
1101144292 12:101826923-101826945 ATTCTGAAGGCTCTCCCTGTGGG + Intronic
1102614235 12:114139150-114139172 ACACTGACCTGTCTCCCAGTAGG + Intergenic
1108016149 13:46078566-46078588 AGACTGACTGGTGTCCTTGTGGG + Intronic
1112335289 13:98510196-98510218 ATACTGACGGACACCCCTGTGGG - Intronic
1115818508 14:37188522-37188544 ATACAGACGGGTGCCCCTCTGGG + Intergenic
1120910810 14:89665130-89665152 ATACTGAAGGAGCTGCCTGTGGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1126086989 15:45020476-45020498 ATACAGGCGGGTGCCCCTGTGGG - Intergenic
1131887191 15:96928806-96928828 ATGCTGAAGGGTCTCCATTTGGG + Intergenic
1133416007 16:5607514-5607536 ATACTGACGGGTTTCAATGTTGG + Intergenic
1134716050 16:16358460-16358482 ACAGTGACGGGGCTCCCAGTGGG + Intergenic
1134958706 16:18393699-18393721 ACAGTGACGGGGCTCCCAGTGGG - Intergenic
1136736200 16:32469760-32469782 ATACAGAGGGATCTCCCTGCAGG - Intergenic
1142191923 16:88722066-88722088 AAACACGCGGGTCTCCCTGTAGG - Exonic
1203016872 16_KI270728v1_random:359814-359836 ATACAGAGGGATCTCCCTGCAGG + Intergenic
1203035207 16_KI270728v1_random:632972-632994 ATACAGAGGGATCTCCCTGCAGG + Intergenic
1143178635 17:4970681-4970703 ATACTGATGGGGCTCCCACTTGG + Intronic
1151310153 17:73287867-73287889 AGCCTGACAGGTCTCCCTGTTGG + Intronic
1151523632 17:74648685-74648707 ATCCTGACGGGTCTAGCTGAGGG - Intergenic
927798592 2:26075319-26075341 ATAAGGACTGTTCTCCCTGTTGG - Intronic
933215144 2:79621100-79621122 CTACTGTGGTGTCTCCCTGTGGG + Intronic
934107594 2:88709944-88709966 CTACTGAAGGTTCTCCCTTTGGG + Intronic
934856214 2:97731995-97732017 ATGCTGACTGGTGTCACTGTGGG + Intronic
935545882 2:104399158-104399180 ATACTGTCAGGTTTCCCTGAGGG - Intergenic
935697832 2:105785424-105785446 ACACTCACATGTCTCCCTGTAGG - Intronic
935782119 2:106517567-106517589 AGGCTGACGGGGCTCTCTGTGGG - Intergenic
948705417 2:239789341-239789363 ATACTGACGGGTCTCCCTGTGGG - Intronic
1173554011 20:43952801-43952823 GTACTTACGGGACTCACTGTGGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1182436907 22:30336738-30336760 GTGCTGCTGGGTCTCCCTGTTGG + Intronic
951640884 3:24833779-24833801 ATACTGGCAGGTCTACCTGTGGG - Intergenic
955410024 3:58649307-58649329 ATACTCACGGATCTCCTTGGTGG + Exonic
956911933 3:73827195-73827217 ATAATGGCTGGTCTCACTGTGGG - Intergenic
961443955 3:126969577-126969599 ATGCTTACTGGTCTCCCTGGAGG - Intergenic
961736057 3:129002804-129002826 AGACTTATGGGGCTCCCTGTGGG + Intronic
987082084 5:14435036-14435058 ATCCTGAGACGTCTCCCTGTCGG + Intronic
1002465509 5:179406330-179406352 ATACTCACGGGCCTCACTGCAGG + Intergenic
1003898863 6:10634361-10634383 ATACTGAACTATCTCCCTGTTGG - Exonic
1005392656 6:25349478-25349500 CTACAGACGGGTGGCCCTGTGGG + Intronic
1010475293 6:76279485-76279507 ATTCAGATGGTTCTCCCTGTTGG + Intergenic
1012598050 6:101062754-101062776 ATACAGGCGGGTGTCCCTCTGGG + Intergenic
1012909649 6:105104550-105104572 TTTCTGGCGGGTCTCCCAGTGGG + Intronic
1013514226 6:110871055-110871077 GTACTGACCTGTCTCCCTTTAGG - Intronic
1013974341 6:116059960-116059982 CTACTCACGGCTCTGCCTGTAGG + Exonic
1019107591 6:169681733-169681755 ATACGGGCAAGTCTCCCTGTGGG - Intronic
1023034769 7:36120697-36120719 ATACAGACGGGTGCCCCTCTGGG + Intergenic
1030650104 7:112108533-112108555 ATACTGTTGGGTCACCCTGCTGG + Intronic
1031954078 7:127924178-127924200 ATCCTGATGGGCCTCCCTGGAGG - Intronic
1035663186 8:1362470-1362492 ACACTGACGGGTGTCCCCGCCGG - Intergenic
1036288185 8:7462902-7462924 ATGCTGACGGGTCTGCCAGGCGG - Intronic
1036333290 8:7848626-7848648 ATGCTGACGGGTCTGCCAGGCGG + Intronic
1049657261 8:143804390-143804412 ATACTGAGGAGTCTGGCTGTGGG + Intronic
1199292403 X:146119600-146119622 ATACAGACAGGTGTCCCTCTTGG + Intergenic
1200666183 Y:6027733-6027755 ATACTGACTGGTTTTCCTTTGGG - Intergenic