ID: 948709625

View in Genome Browser
Species Human (GRCh38)
Location 2:239817722-239817744
Sequence TGAGGTCCAGGCTAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948709625_948709627 -7 Left 948709625 2:239817722-239817744 CCTGGCTATTAGCCTGGACCTCA No data
Right 948709627 2:239817738-239817760 GACCTCATCTGATCATTCACCGG No data
948709625_948709631 28 Left 948709625 2:239817722-239817744 CCTGGCTATTAGCCTGGACCTCA No data
Right 948709631 2:239817773-239817795 AGCCCCATCTGATCACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948709625 Original CRISPR TGAGGTCCAGGCTAATAGCC AGG (reversed) Intergenic
No off target data available for this crispr