ID: 948711458

View in Genome Browser
Species Human (GRCh38)
Location 2:239828071-239828093
Sequence TCATATGAGGTGAAGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948711453_948711458 -4 Left 948711453 2:239828052-239828074 CCATAAAATTGGACAAATGTCAT No data
Right 948711458 2:239828071-239828093 TCATATGAGGTGAAGGGAGAGGG No data
948711452_948711458 3 Left 948711452 2:239828045-239828067 CCACTGGCCATAAAATTGGACAA No data
Right 948711458 2:239828071-239828093 TCATATGAGGTGAAGGGAGAGGG No data
948711449_948711458 9 Left 948711449 2:239828039-239828061 CCCGAACCACTGGCCATAAAATT No data
Right 948711458 2:239828071-239828093 TCATATGAGGTGAAGGGAGAGGG No data
948711450_948711458 8 Left 948711450 2:239828040-239828062 CCGAACCACTGGCCATAAAATTG No data
Right 948711458 2:239828071-239828093 TCATATGAGGTGAAGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948711458 Original CRISPR TCATATGAGGTGAAGGGAGA GGG Intergenic
No off target data available for this crispr