ID: 948713038

View in Genome Browser
Species Human (GRCh38)
Location 2:239837005-239837027
Sequence ATGGATGACCAGCTGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948713032_948713038 26 Left 948713032 2:239836956-239836978 CCTGCCTAGTAGAAGGGGGCTAC No data
Right 948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG No data
948713033_948713038 22 Left 948713033 2:239836960-239836982 CCTAGTAGAAGGGGGCTACCCTC No data
Right 948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG No data
948713034_948713038 4 Left 948713034 2:239836978-239837000 CCCTCTCTGCTGAGAGCTGAAGA No data
Right 948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG No data
948713035_948713038 3 Left 948713035 2:239836979-239837001 CCTCTCTGCTGAGAGCTGAAGAG No data
Right 948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948713038 Original CRISPR ATGGATGACCAGCTGCAGAG AGG Intergenic
No off target data available for this crispr