ID: 948715597

View in Genome Browser
Species Human (GRCh38)
Location 2:239859200-239859222
Sequence GAGAACTGCAGGAAGACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948715592_948715597 18 Left 948715592 2:239859159-239859181 CCTATGACACTGACATCCCTATG No data
Right 948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG No data
948715594_948715597 1 Left 948715594 2:239859176-239859198 CCTATGCCAAAAAAGATGTAAGC No data
Right 948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG No data
948715593_948715597 2 Left 948715593 2:239859175-239859197 CCCTATGCCAAAAAAGATGTAAG No data
Right 948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG No data
948715595_948715597 -5 Left 948715595 2:239859182-239859204 CCAAAAAAGATGTAAGCAGAGAA No data
Right 948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948715597 Original CRISPR GAGAACTGCAGGAAGACTTC TGG Intergenic
No off target data available for this crispr