ID: 948717134

View in Genome Browser
Species Human (GRCh38)
Location 2:239872128-239872150
Sequence CATGGGATTGGGGGTTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948717121_948717134 14 Left 948717121 2:239872091-239872113 CCGGGGTGTCTCTGGGCTGCCCT No data
Right 948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG No data
948717122_948717134 -5 Left 948717122 2:239872110-239872132 CCCTGATCCAACGCCTCCCATGG No data
Right 948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG No data
948717118_948717134 22 Left 948717118 2:239872083-239872105 CCACAGGACCGGGGTGTCTCTGG No data
Right 948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG No data
948717124_948717134 -6 Left 948717124 2:239872111-239872133 CCTGATCCAACGCCTCCCATGGG No data
Right 948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG No data
948717117_948717134 23 Left 948717117 2:239872082-239872104 CCCACAGGACCGGGGTGTCTCTG No data
Right 948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG No data
948717115_948717134 27 Left 948717115 2:239872078-239872100 CCCTCCCACAGGACCGGGGTGTC No data
Right 948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG No data
948717116_948717134 26 Left 948717116 2:239872079-239872101 CCTCCCACAGGACCGGGGTGTCT No data
Right 948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948717134 Original CRISPR CATGGGATTGGGGGTTGCCC TGG Intergenic
No off target data available for this crispr