ID: 948717161

View in Genome Browser
Species Human (GRCh38)
Location 2:239872275-239872297
Sequence TTCCCCCGATTCCAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948717158_948717161 12 Left 948717158 2:239872240-239872262 CCCGGGGGGCAGCTCTTGGGAAG No data
Right 948717161 2:239872275-239872297 TTCCCCCGATTCCAGAAGACAGG No data
948717154_948717161 22 Left 948717154 2:239872230-239872252 CCTGAGAGTCCCCGGGGGGCAGC No data
Right 948717161 2:239872275-239872297 TTCCCCCGATTCCAGAAGACAGG No data
948717159_948717161 11 Left 948717159 2:239872241-239872263 CCGGGGGGCAGCTCTTGGGAAGA No data
Right 948717161 2:239872275-239872297 TTCCCCCGATTCCAGAAGACAGG No data
948717157_948717161 13 Left 948717157 2:239872239-239872261 CCCCGGGGGGCAGCTCTTGGGAA No data
Right 948717161 2:239872275-239872297 TTCCCCCGATTCCAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948717161 Original CRISPR TTCCCCCGATTCCAGAAGAC AGG Intergenic
No off target data available for this crispr