ID: 948723104

View in Genome Browser
Species Human (GRCh38)
Location 2:239913570-239913592
Sequence TCAATACTGCGGGGAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948723097_948723104 9 Left 948723097 2:239913538-239913560 CCCTGGGGCTGTCTGCTACCACT 0: 1
1: 0
2: 2
3: 19
4: 196
Right 948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
948723098_948723104 8 Left 948723098 2:239913539-239913561 CCTGGGGCTGTCTGCTACCACTG 0: 1
1: 0
2: 0
3: 22
4: 232
Right 948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
948723096_948723104 10 Left 948723096 2:239913537-239913559 CCCCTGGGGCTGTCTGCTACCAC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
948723094_948723104 23 Left 948723094 2:239913524-239913546 CCACGTGATTCTCCCCCTGGGGC 0: 1
1: 0
2: 0
3: 18
4: 386
Right 948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
948723095_948723104 11 Left 948723095 2:239913536-239913558 CCCCCTGGGGCTGTCTGCTACCA 0: 1
1: 0
2: 0
3: 25
4: 213
Right 948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
948723099_948723104 -9 Left 948723099 2:239913556-239913578 CCACTGCAGACATCTCAATACTG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
948723090_948723104 26 Left 948723090 2:239913521-239913543 CCTCCACGTGATTCTCCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 948723104 2:239913570-239913592 TCAATACTGCGGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948723104 Original CRISPR TCAATACTGCGGGGAGCTCT GGG Intronic