ID: 948725391

View in Genome Browser
Species Human (GRCh38)
Location 2:239930847-239930869
Sequence CGGGTACAGCATGCCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948725375_948725391 30 Left 948725375 2:239930794-239930816 CCAGGAGGGGTGTGGCAGGGAGG 0: 3
1: 0
2: 6
3: 79
4: 718
Right 948725391 2:239930847-239930869 CGGGTACAGCATGCCCAGGAGGG 0: 2
1: 0
2: 1
3: 8
4: 124
948725387_948725391 -5 Left 948725387 2:239930829-239930851 CCGCAGGGTCCTGGTGGACGGGT 0: 2
1: 0
2: 0
3: 8
4: 117
Right 948725391 2:239930847-239930869 CGGGTACAGCATGCCCAGGAGGG 0: 2
1: 0
2: 1
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948725391 Original CRISPR CGGGTACAGCATGCCCAGGA GGG Intronic
900898613 1:5501853-5501875 CATGTACAGCCTGCTCAGGAAGG - Intergenic
901487622 1:9575953-9575975 AGGTGACAGCATGACCAGGAAGG - Intronic
901625881 1:10624797-10624819 AGGTCACAGCATGGCCAGGAGGG + Intronic
903082287 1:20820339-20820361 CAGGTGCTGCATGCCTAGGAGGG - Intronic
904891914 1:33785674-33785696 AGGATAGGGCATGCCCAGGATGG - Intronic
907311336 1:53540726-53540748 CAGGGACCGCCTGCCCAGGATGG + Intronic
907751219 1:57265087-57265109 AGGGAACAGCAGCCCCAGGATGG + Intronic
909631630 1:77774567-77774589 CAGGGACAGCATGGCCTGGATGG + Intergenic
910763620 1:90759106-90759128 ATGGGACAGAATGCCCAGGAAGG - Intergenic
922321996 1:224496573-224496595 TGGTTTCAGCATGCCCAGGAAGG + Intronic
922322122 1:224498094-224498116 TGGTTTCAGGATGCCCAGGAAGG - Intronic
922752196 1:228075497-228075519 GGGATACAGTGTGCCCAGGAAGG + Exonic
1063577111 10:7272109-7272131 CAGGCTCAGCATGTCCAGGAAGG + Intronic
1066182943 10:32981104-32981126 CCGATACAGCTGGCCCAGGAGGG + Intronic
1067153170 10:43753116-43753138 CGGGTGCACCATGCCCAGGCTGG - Intergenic
1067796435 10:49325365-49325387 GGGGTCGAGCATGGCCAGGATGG + Exonic
1068954058 10:62805667-62805689 CGGGGCCAGGATGTCCAGGAAGG - Exonic
1069508583 10:69023157-69023179 CAGGTACAGCACGACCTGGATGG - Intergenic
1069726798 10:70585443-70585465 GGGGTCCAGCGTGCCCAGCATGG + Intergenic
1071555520 10:86598539-86598561 TGGGAACAGCTTGACCAGGAGGG + Intergenic
1072234078 10:93438324-93438346 CTGGTACAGTATGGGCAGGAAGG - Intronic
1073447655 10:103591005-103591027 AGGCTGCAGCCTGCCCAGGACGG - Exonic
1075282263 10:121149336-121149358 CGGCTTCATCATGGCCAGGAGGG - Intergenic
1078100603 11:8328391-8328413 CAGGTGCAGCATGTCCAGGCTGG + Intergenic
1078100798 11:8329233-8329255 CGGCTACAGCCAGGCCAGGACGG + Intergenic
1079144458 11:17838264-17838286 GGGGTGCAGCATGCCAGGGAAGG + Intronic
1081593543 11:44443879-44443901 CCGGTACGGCATGCCCAGGGTGG + Intergenic
1085454251 11:76656806-76656828 TGGGGAGAGCATGCCCAGCAGGG + Intergenic
1086373153 11:86174755-86174777 CTGGACCAACATGCCCAGGAGGG + Intergenic
1089302771 11:117508504-117508526 GGGGTACGGCAAGCACAGGATGG + Intronic
1091079235 11:132651034-132651056 CGGTTGCAGCAGGCCCAGGGAGG - Intronic
1092403906 12:8202672-8202694 CAAGAACAGCATGCCCAAGATGG + Intergenic
1100082050 12:90864403-90864425 CGGAAATAACATGCCCAGGATGG + Intergenic
1102007216 12:109596548-109596570 CGAGTCCAGCAAGCCCTGGATGG + Exonic
1103767716 12:123293519-123293541 GGGGTGCTGCATGCCCAGGCTGG - Exonic
1107181912 13:37471364-37471386 CAGGTTCAGCAGGCCCAGTAGGG - Intergenic
1108287524 13:48923388-48923410 CAGGTACAGTATTCCTAGGAGGG + Intergenic
1109634052 13:65090237-65090259 TAGAAACAGCATGCCCAGGAAGG + Intergenic
1111642884 13:90993431-90993453 CTGGGGCAGAATGCCCAGGAAGG - Intergenic
1122134256 14:99623779-99623801 CAGGTACAGCAGGCTCGGGAGGG - Intergenic
1122277642 14:100603490-100603512 CGGGTACAGCAGGGGCGGGAGGG - Intergenic
1129415041 15:75371728-75371750 TGGGTATAGCCTGCCCTGGAGGG - Exonic
1132233156 15:100199968-100199990 CGTGGACAGCACGCCCCGGAAGG + Intronic
1142493019 17:290650-290672 CAGGTACTTCATGCCCAGGCTGG + Intronic
1156263527 18:35466545-35466567 GGGGTACAGCATGGACAGCAAGG + Intronic
1158960249 18:62582237-62582259 CGGGTTAGGCATGGCCAGGAGGG + Intronic
1160789919 19:918589-918611 CGGGTACAGCAGGGCCGTGAAGG - Exonic
1163289590 19:16370613-16370635 TGGGTACAGTGTGCCCAGGAAGG + Intronic
1165015415 19:32876697-32876719 CGAGTCCAGGATGCCAAGGAGGG - Intergenic
1165349706 19:35269097-35269119 CGGGTCCAGCATGTCCATGGGGG - Exonic
1165994359 19:39833609-39833631 CGGTCTCAGCAGGCCCAGGAGGG - Exonic
1166444463 19:42846703-42846725 CGAGTGCAGCATGGCCAGTATGG - Intronic
1166470298 19:43074039-43074061 CGAGTGCAGCATGGCCAGTATGG - Intronic
925279234 2:2671118-2671140 GGGGTCCAGGAGGCCCAGGAAGG + Intergenic
925981922 2:9184187-9184209 CAGGAACAGCATGGCCAGGGAGG - Intergenic
926248838 2:11141563-11141585 CTGGTCAAGCCTGCCCAGGAAGG - Intronic
927489713 2:23513020-23513042 CGCGTGAAGCATGCCAAGGATGG - Intronic
927684146 2:25159306-25159328 CAGGCCCAGCATGCCCAGCATGG + Intergenic
928549420 2:32356970-32356992 CGGGTGGAGCATGCGCGGGAGGG - Intergenic
932618486 2:73251415-73251437 CGGGCTCGGCATGCCCAGGTGGG + Exonic
932838705 2:75061237-75061259 CGGGTACAGCCTGCCTCTGAGGG + Intronic
933899099 2:86836401-86836423 GGGGTGCGGCATGGCCAGGATGG - Intronic
934856974 2:97735502-97735524 CATGTCCACCATGCCCAGGATGG - Intronic
937237315 2:120438598-120438620 TGGGTCCTGCAGGCCCAGGATGG + Intergenic
937309689 2:120894474-120894496 AGGGAACAGAATGCTCAGGAGGG - Intronic
938333204 2:130463518-130463540 CAGGGACAGCATGGCCTGGATGG + Exonic
938356608 2:130657153-130657175 CAGGGACAGCATGGCCTGGATGG - Exonic
941622171 2:167790357-167790379 CTGGCACAGAATGTCCAGGAGGG + Intergenic
948434236 2:237942251-237942273 CGGTAACAACAAGCCCAGGAAGG - Intergenic
948498150 2:238368214-238368236 TGGGTAAAGCAGGCTCAGGAGGG + Intronic
948586118 2:239020781-239020803 CGGGAACAGCCTGCCCCAGAGGG - Intergenic
948725391 2:239930847-239930869 CGGGTACAGCATGCCCAGGAGGG + Intronic
948725423 2:239930933-239930955 CGGGTACAGCATGCCCAGGAGGG + Intronic
948800995 2:240433553-240433575 CGTGTGCAGCATTGCCAGGAGGG + Intergenic
948862630 2:240760288-240760310 CGGGTACAGCAGGGCCTGAAGGG - Intronic
1169130058 20:3161957-3161979 AGGGAACAACATGCCAAGGATGG + Intergenic
1169257612 20:4110983-4111005 AGGCTACAGCAGCCCCAGGAGGG - Intergenic
1174529034 20:51196439-51196461 CGGATACTGAATGCCCAGGCGGG - Intergenic
1175965066 20:62656295-62656317 CGGGTACAGCACATCCAGGAGGG - Intronic
1176225096 20:63993013-63993035 CGAGAACAGCCTGGCCAGGATGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1178981372 21:37267694-37267716 CGGTTGCAGCCTGCGCAGGAAGG + Intronic
1179908930 21:44437904-44437926 GGGGTACAGCCTGCCCCGCAGGG + Intronic
1180534814 22:16387792-16387814 CGGGTGCACGATGTCCAGGATGG - Intergenic
1180979806 22:19873172-19873194 AGGGTGCAGCATGCTCAGGGAGG + Intergenic
1181265461 22:21628521-21628543 CGGGCCCAGCTTGCCCAGGATGG - Exonic
1183910395 22:41074815-41074837 CAGGGACAGCATGGCCTGGATGG + Intergenic
953360119 3:42288542-42288564 CAGGCACAGGATGCCAAGGAAGG + Intergenic
954749977 3:52807982-52808004 TGGGTACAGGGTGCCTAGGAAGG - Intronic
961311716 3:126006503-126006525 GGTGTACAGCCTCCCCAGGATGG - Exonic
966443048 3:179967916-179967938 CTGTTTCAGCATCCCCAGGAGGG - Intronic
969762146 4:9195093-9195115 CAAGAACAGCATGCCCAAGATGG - Intergenic
970559193 4:17266345-17266367 CAGGTTAAGGATGCCCAGGAAGG - Intergenic
976474094 4:85462709-85462731 CTGGGACAGAATGCCTAGGATGG - Intergenic
984193358 4:176630282-176630304 TGGGCAGAGAATGCCCAGGAGGG - Intergenic
984937216 4:184899723-184899745 TGGGTACATCATGCACAGCAGGG + Intergenic
988332867 5:29865053-29865075 GGGGTAGATCATACCCAGGAAGG - Intergenic
988642421 5:33055642-33055664 CGGGAACAGCATGGGCAGAATGG - Intergenic
992252110 5:74886029-74886051 CGAGTACAGCATGGCCAAGATGG + Intergenic
993620537 5:90162690-90162712 CTGGTTCTGCATGCCCAGCAAGG + Intergenic
996885550 5:128349986-128350008 CAGATACAGCTTGCCCAAGAGGG - Exonic
998461031 5:142310197-142310219 AGGGGACAGCTTTCCCAGGAAGG + Intergenic
1000242151 5:159418612-159418634 CTATTACAGCATGCCCAAGATGG + Intergenic
1012389825 6:98725573-98725595 AGGGTGCAACATGCCCAGAAGGG + Intergenic
1015588992 6:134804525-134804547 CGGGACCAGCATGACCAGCATGG + Intergenic
1017988437 6:159465427-159465449 CAGCTACAGCATCCCCAGAATGG - Intergenic
1018890250 6:167977418-167977440 AGGGGACAGCAGGCCCCGGATGG - Intergenic
1018890375 6:167977706-167977728 AGGGGACAGCAGGCCCCGGATGG - Intergenic
1019535942 7:1530021-1530043 GGGACACAGCAGGCCCAGGATGG - Intergenic
1022029482 7:26479269-26479291 CAGGGACAGCCTGCCCAGAACGG - Intergenic
1022642484 7:32201466-32201488 GGGGTACAGCATTCCCATTAAGG + Intronic
1022668227 7:32430895-32430917 GGGGTGCAGCTTGCTCAGGAAGG - Intergenic
1024284731 7:47747321-47747343 AGATTACAGCATGCCCGGGAAGG - Intronic
1026637210 7:72094672-72094694 CTTCTACAGTATGCCCAGGAAGG - Intronic
1026931899 7:74227606-74227628 TGGGTACAGGAAGCCCAGGAAGG + Intronic
1032761750 7:134949985-134950007 GGGCCACATCATGCCCAGGATGG - Intronic
1034284260 7:149874040-149874062 CGGGCGCAGGATGCCCAGGCAGG - Exonic
1034490549 7:151391051-151391073 CGGGTCCAGGAAGCACAGGAGGG - Intronic
1035056934 7:156041894-156041916 AGGTTACAGCATGCCCAGGACGG - Intergenic
1036272236 8:7316841-7316863 CAAGAACAGCATGCCCAAGATGG - Intergenic
1036349112 8:7993501-7993523 CAAGAACAGCATGCCCAAGATGG + Intergenic
1036844389 8:12153974-12153996 CAAGAACAGCATGCCCAAGATGG + Intergenic
1036865761 8:12396296-12396318 CAAGAACAGCATGCCCAAGATGG + Intergenic
1038204881 8:25457526-25457548 CGGGTACAGCAGACCCAAAAGGG - Intronic
1045069018 8:98480712-98480734 CGTGTACAGCATACCAAGGTTGG - Intronic
1049256882 8:141618899-141618921 CGGGTGCAGCTAGCACAGGATGG + Intergenic
1049497809 8:142944817-142944839 CGGGTACAGGCTGCTCAGAAAGG - Intergenic
1057143320 9:92740916-92740938 CAGGGAGTGCATGCCCAGGAGGG + Intronic
1058953702 9:109926526-109926548 TGGGTACAGCATGGGGAGGATGG + Intronic
1059602161 9:115790853-115790875 CGGATACAGGGTGGCCAGGAGGG - Intergenic
1060664052 9:125422474-125422496 AGGGTACAGCACGCCCTGCAGGG + Intergenic
1060961650 9:127684952-127684974 AGGGAACACCATGTCCAGGAAGG + Intronic
1062420014 9:136476121-136476143 TGGGCACAGCTGGCCCAGGAAGG + Exonic
1062716027 9:138010531-138010553 TGGGGAGAGCATGACCAGGAGGG - Intronic
1190822302 X:53985173-53985195 CATGCACAGCATGCCCTGGATGG + Exonic