ID: 948725765

View in Genome Browser
Species Human (GRCh38)
Location 2:239933046-239933068
Sequence CCGTGGCAGGGCCTGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 626}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948725755_948725765 0 Left 948725755 2:239933023-239933045 CCGTGTAGGTTGTGGTCTGTCTC 0: 1
1: 0
2: 0
3: 5
4: 118
Right 948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG 0: 1
1: 0
2: 5
3: 76
4: 626
948725754_948725765 1 Left 948725754 2:239933022-239933044 CCCGTGTAGGTTGTGGTCTGTCT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG 0: 1
1: 0
2: 5
3: 76
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948725765 Original CRISPR CCGTGGCAGGGCCTGGGATG GGG Intronic
900122696 1:1055621-1055643 CCCTCGCAGGGCCTGGGGTGTGG - Exonic
900205014 1:1427937-1427959 CCGTGGCGGGGGCGGGGCTGCGG - Intergenic
900234915 1:1583831-1583853 CCGTTGCAGGGCCTGGGACCCGG + Intergenic
900408053 1:2501013-2501035 CCATGCCAGTGCATGGGATGAGG + Intronic
900626237 1:3609951-3609973 CCCTGGCTGGTCCTGGGAGGAGG + Intronic
900673992 1:3872662-3872684 CCGTGGCAGGGACAGGGCCGTGG - Intronic
900713192 1:4128000-4128022 CAGTGGCAGGGCTGGGGACGAGG - Intergenic
901051966 1:6429802-6429824 ACCTGGCATGGCCTGGGAGGGGG - Intronic
901144139 1:7053791-7053813 CCATAGCAGGGCCTGGGACCTGG + Intronic
901200335 1:7463247-7463269 CCCAGGCAGGGCATGGGAGGTGG + Intronic
901238237 1:7678944-7678966 CTGGGGCAGGGACTGGGATAAGG - Intronic
901337745 1:8465786-8465808 CCGTGGCAGCGCCAGGCAGGAGG - Intronic
901628102 1:10634930-10634952 CTGGGGCGGGGCCTGGGATGTGG + Intergenic
901642325 1:10699005-10699027 CCATGGCCTGGCCTGGGTTGGGG + Intronic
902370961 1:16006563-16006585 ACTTTGCAGGGCCTGGCATGTGG - Exonic
902482270 1:16718212-16718234 ACCTGGCATGGCCTGGGAGGGGG + Intergenic
902713413 1:18256078-18256100 AGGTGGGAGGGCCTGGGTTGGGG - Intronic
903071028 1:20727106-20727128 CCAAGGCAGGGTCTGGGAGGTGG - Intronic
903233977 1:21937578-21937600 CCGGGCCCGGGCATGGGATGGGG + Intergenic
903287250 1:22284987-22285009 CCTGGGCTGGGCCTGGGATCTGG + Intergenic
903665005 1:25000975-25000997 ACTGGGGAGGGCCTGGGATGAGG - Intergenic
903797428 1:25940313-25940335 CAGTGGCAAGGCCTGGGACTGGG + Intergenic
903857616 1:26346031-26346053 CCGTGGCAGGGCCTCGCCTGAGG + Exonic
904012850 1:27399588-27399610 CTGGGGTAGGCCCTGGGATGGGG + Intergenic
904402387 1:30265381-30265403 CCGTGGCAGGCCCTGAGGAGTGG - Intergenic
904424197 1:30413101-30413123 CTGTGGCAGGGCCCGGTTTGTGG + Intergenic
904424373 1:30414105-30414127 CTGTGGCAGGGCCCGGTTTGTGG + Intergenic
904577935 1:31517451-31517473 CCCTCGCAGGGCCTGCAATGGGG + Intergenic
904624016 1:31792179-31792201 CAGAGGCAGGGTCTGGTATGGGG + Intronic
905462198 1:38129206-38129228 CCTTGGCCGGGCCTGGGGAGGGG - Intergenic
905558655 1:38908594-38908616 CCCTCGCAGGGCGTGCGATGGGG + Intronic
905661226 1:39727693-39727715 CCTTCACAGGGCGTGGGATGGGG + Intronic
906480179 1:46194510-46194532 ATGGGGCAGGGCCTGGGCTGGGG - Intronic
906654063 1:47534736-47534758 GTCTGGCAGGGCCAGGGATGGGG - Intergenic
906743537 1:48205858-48205880 CGGAGGCAGAGCCTGGGATCTGG - Intergenic
906751522 1:48267131-48267153 CCATCGCAGGCCCTGAGATGGGG - Intergenic
907038137 1:51234936-51234958 CCGTGGCAGGGTGTGGGCTTAGG + Intergenic
907274859 1:53311366-53311388 CCCTGGCAGTTCCTGGGGTGTGG + Intronic
907312594 1:53547528-53547550 CTGGGTCAGGGCCTGGGAAGTGG - Intronic
907331821 1:53676612-53676634 CTGTGGCAGGGCTGGGGCTGGGG - Intronic
908908784 1:69047865-69047887 CCCTCGCAGGGCATGTGATGGGG - Intergenic
909561587 1:77014463-77014485 CCTGGGCAGGGCCTGGGTGGGGG - Intronic
909863052 1:80632993-80633015 CCCTTGCAGGGCATGTGATGGGG - Intergenic
910477255 1:87620412-87620434 CCCTTGCAGGGCATGTGATGGGG - Intergenic
912190162 1:107329251-107329273 CCTTTGCAGGTCCTGGGATTAGG - Intronic
913057928 1:115179288-115179310 CTGTGGTAGGGCTTGGGGTGGGG + Intergenic
913957966 1:143320836-143320858 CCGTGGCAGGACCAGCAATGGGG + Intergenic
914052275 1:144146194-144146216 CCGTGGCAGGACCAGCAATGGGG + Intergenic
914126922 1:144820347-144820369 CCGTGGCAGGACCAGCAATGGGG - Intergenic
914977220 1:152377841-152377863 CCCTTGCAGGGCATGTGATGGGG + Intergenic
915001861 1:152601214-152601236 CCTTGGCAGGGGCAGGGATGAGG - Intergenic
915597403 1:156903458-156903480 CCTGGGTAGGGCCTGGGCTGGGG + Intronic
915835430 1:159171897-159171919 CCGAGGCGGGGGCTGGGATCGGG + Intronic
916045870 1:160999580-160999602 CCATGCCAGGCCCTGGGATGGGG + Intronic
916090625 1:161305652-161305674 CTCTGGCAGGGCCTGGGGTGGGG + Exonic
916233288 1:162561471-162561493 CCGGGGCGGGGCTAGGGATGGGG - Intergenic
919928068 1:202202944-202202966 CAGTGTCAGGGACTTGGATGTGG + Intronic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
920456734 1:206107377-206107399 CAGTGGAAGGGCCTTGGATAGGG - Intergenic
921116095 1:212093142-212093164 CCCTTGCAGGGCGTGCGATGAGG + Intronic
921785959 1:219229780-219229802 CCCTCGCAGGGCATGCGATGAGG - Intergenic
921956120 1:220984452-220984474 CCCTCGCAGGGCGTGAGATGGGG - Intergenic
922917665 1:229271427-229271449 GCGGGGCCGGGCCTGGGCTGCGG + Intronic
923045830 1:230355020-230355042 CAGAAGCAGGGCCTGAGATGAGG - Intronic
924572126 1:245246497-245246519 CAGAGGCAGGGCCTGGGTGGTGG - Intronic
924707029 1:246509945-246509967 CCTAGGCAGGGCCTGATATGGGG + Intergenic
924955272 1:248920309-248920331 CCCTGACAGGTCCTGGTATGAGG + Intergenic
1062902231 10:1154964-1154986 CAGTTGCAGGGCCTGGGATGGGG + Intergenic
1063042578 10:2358482-2358504 CCGTAGCTGGGGCTGGGGTGTGG - Intergenic
1064640661 10:17412242-17412264 AGGTTGGAGGGCCTGGGATGAGG - Intronic
1064795764 10:19009670-19009692 CCCTTGCAGGGCGTGCGATGGGG + Intergenic
1065449419 10:25841259-25841281 CCCTGACAGGGCCTGGTGTGTGG - Intergenic
1066026226 10:31362519-31362541 ACGGGGCAGGGCCTGGGCAGAGG + Intronic
1066055546 10:31677442-31677464 CTGAGGCAGTGCCTGGGGTGGGG - Intergenic
1066561252 10:36672159-36672181 GGGAGGCAGGGCATGGGATGGGG + Intergenic
1066759520 10:38739110-38739132 CCGGGGCAGGGCAAGGGCTGGGG - Intergenic
1066986922 10:42476057-42476079 TCCTGGCTCGGCCTGGGATGGGG - Intergenic
1067526196 10:47040173-47040195 CCATGGCAGGGCCTGTGCTCTGG + Intergenic
1067818879 10:49508879-49508901 TCTTGGCAGCGTCTGGGATGAGG - Intronic
1068134862 10:52941288-52941310 CCTTCGCAGGGCGTGCGATGGGG - Intergenic
1069511462 10:69045903-69045925 CCCAGGCAGGGCCTGGGACAGGG - Intergenic
1069611154 10:69773475-69773497 CCGTGGCAAGGCCTGGCTGGCGG + Intergenic
1070655694 10:78269682-78269704 CTGTGGCTGGGACTGGGATAGGG + Intergenic
1071008133 10:80907296-80907318 CCGTCACACTGCCTGGGATGTGG - Intergenic
1071866992 10:89746007-89746029 CCCTCGCAGGGCATGCGATGGGG + Intronic
1072633829 10:97164772-97164794 CCGTGGCATTGCCAGGGGTGGGG + Intronic
1073443340 10:103565533-103565555 CCTGGGCAGTGCCTAGGATGTGG - Intronic
1073509649 10:104035080-104035102 CCGTGGCAGGGACAGAGGTGGGG - Intronic
1075216155 10:120537933-120537955 CTGTGGCAGGGCCCTGGCTGAGG - Intronic
1075536708 10:123277616-123277638 ATGTGGTTGGGCCTGGGATGAGG - Intergenic
1075675494 10:124293146-124293168 CAGCGCCAGGGCCTGTGATGAGG + Intergenic
1076544636 10:131237066-131237088 CAGCGGCAGGGCATGGGGTGAGG - Intronic
1076630149 10:131847457-131847479 GCGTGGCAGGCCCTGCGCTGTGG - Intergenic
1076738168 10:132467964-132467986 CCGTGGCTGGCCCTGGGAGGGGG - Intergenic
1077050638 11:565030-565052 CCCAGGCAGGGGCTGGGCTGTGG - Intergenic
1077163034 11:1122208-1122230 CCCGAGGAGGGCCTGGGATGTGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077231226 11:1458985-1459007 CAGGGGCAGGGCCTGGAGTGAGG - Intronic
1077552216 11:3205593-3205615 CCGTGGCAGGTCCTGGGGCCGGG + Intergenic
1077608558 11:3628702-3628724 ACCTGGCAGGGGGTGGGATGTGG - Intergenic
1078003209 11:7513870-7513892 CTGTGGCAGGTCCCGGGGTGGGG + Exonic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1079122519 11:17695914-17695936 CCGGGGCCGGGCCGGGGCTGCGG + Intergenic
1079203624 11:18395436-18395458 AGGTGGGAGGGCATGGGATGAGG - Intronic
1079242175 11:18728860-18728882 CCGAGGCAGGGCCCTGGGTGAGG + Exonic
1079972124 11:27048264-27048286 GGGTGCCAGGGCCTGGGAGGTGG - Intronic
1080274874 11:30492763-30492785 GGGTGGCAGGGGTTGGGATGTGG - Intronic
1081522562 11:43897289-43897311 GAATGGCTGGGCCTGGGATGTGG - Intronic
1083664203 11:64265829-64265851 CCGTCACATGGACTGGGATGGGG - Intronic
1083793148 11:64999022-64999044 CTGGGGCAGGGGCTGGGATCTGG - Intergenic
1083828941 11:65218792-65218814 CCGAGGCAGGGCATGGCCTGTGG - Intergenic
1084187979 11:67485178-67485200 CCCTCGCAGGGCGTGCGATGGGG + Intronic
1084205936 11:67592980-67593002 CCCTTGCAGGGCATGTGATGGGG + Intergenic
1084396505 11:68914387-68914409 CCCTCGCAGGGCGTGGGATGGGG + Intronic
1084419695 11:69054116-69054138 CTGTGGCCGGGCCTGGGGGGTGG + Intronic
1084426502 11:69087034-69087056 CCCTGGAGGGGCCGGGGATGGGG + Intronic
1084482578 11:69430361-69430383 AGGCGGCAGGGCCTGGGCTGTGG - Intergenic
1084519846 11:69656423-69656445 TCGTGGCACAGCCAGGGATGGGG - Intronic
1084572088 11:69965988-69966010 GCGTGGCAGGGCCTGGGGAGGGG - Intergenic
1084615604 11:70233863-70233885 CCGTGCCAGGCCCTGGGGAGAGG - Intergenic
1085251263 11:75145350-75145372 CAGTGGCAGAGCCAGGGCTGGGG + Intronic
1085283998 11:75348352-75348374 CCCTGCCTGGGCCTGGGTTGGGG + Intronic
1085315610 11:75543107-75543129 CCCTTGCAGGGCGTGCGATGCGG + Intergenic
1086442979 11:86847313-86847335 GGGTGGCAAGGCCTGGGTTGGGG - Intronic
1087651738 11:100875710-100875732 CCGTCACAGGGCCTGGGGTGTGG + Intronic
1089255594 11:117192375-117192397 CCGGGGCAGGGCCTGGGGGAGGG + Intronic
1089636844 11:119819967-119819989 AGGTGACAGGGGCTGGGATGAGG + Intergenic
1089993386 11:122882776-122882798 CCGTGCCAGGGCCGGGGGTGCGG + Exonic
1090470038 11:126972462-126972484 CTGTGGCTGGGCCTGGAAAGTGG - Intronic
1090802059 11:130179179-130179201 CAGGAGCAGGGCCTCGGATGTGG - Intronic
1091269067 11:134292977-134292999 CCGTGGCAGCCCTTTGGATGTGG + Intronic
1091447748 12:553669-553691 CCCTGGAAGGGGCTGGCATGGGG + Exonic
1091792514 12:3280048-3280070 GTGTGGCTGGTCCTGGGATGGGG + Intronic
1092016026 12:5159141-5159163 CCCTGGAAGGGCCTTGGAAGGGG + Intergenic
1092569507 12:9707631-9707653 CCCTTGCAGGGCATGTGATGGGG - Intergenic
1094361791 12:29638775-29638797 CCCTGGCAGGGTGTGTGATGGGG - Intronic
1095529625 12:43171307-43171329 TCGTGGGAGTGCCTGGGAGGGGG - Intergenic
1095878029 12:47103394-47103416 CTGCAGCAGGGCCTGGAATGTGG + Intronic
1095986987 12:48005246-48005268 CAGGGGCAGGCCCTGGGAAGGGG + Intergenic
1096094394 12:48925006-48925028 CCGGGGCGGGGCCTGGGAGGGGG - Intronic
1096454018 12:51770441-51770463 ACCTGGCAGGGCCTGGGAGATGG + Intronic
1096722202 12:53531744-53531766 CTGTGGCTGGGCAGGGGATGGGG + Exonic
1097170980 12:57112451-57112473 CCATAGCAGGGGCTGGGCTGAGG + Intronic
1099499185 12:83389852-83389874 CCCTCGCAGGGCGTGGGATGGGG - Intergenic
1099540734 12:83904486-83904508 CCGTGGCAGTGTCTTGGAGGGGG + Intergenic
1100619339 12:96256284-96256306 GCATGGTGGGGCCTGGGATGCGG + Intronic
1100641353 12:96484763-96484785 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
1100797676 12:98199323-98199345 CCCTGGCAGGCCCTGGTGTGTGG + Intergenic
1101819530 12:108173241-108173263 TGGTGGGAGGGTCTGGGATGAGG - Intronic
1102220552 12:111191612-111191634 CAGTGGCAGGGCTGGGTATGGGG - Intronic
1102597074 12:114001077-114001099 TCTTGGCAGAGCCTGGGAGGAGG - Intergenic
1102977486 12:117217003-117217025 CTGTGGCAGGGACTGGGGCGGGG + Intronic
1102991507 12:117319567-117319589 CAGTGGCAGGAGCTGGGAAGGGG - Intronic
1103212390 12:119176401-119176423 CCTGGGCAGGGGCTGGGGTGAGG - Intergenic
1103896567 12:124277490-124277512 GTGTGGCAGGTCCTGGGTTGTGG - Intronic
1104054282 12:125217375-125217397 GAGTTTCAGGGCCTGGGATGGGG + Intronic
1104213057 12:126708839-126708861 CTGTGGCTGGGCCAGTGATGGGG - Intergenic
1104247965 12:127061196-127061218 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
1104414392 12:128585870-128585892 GGGTGCCAGGGGCTGGGATGAGG + Intronic
1104718782 12:131033250-131033272 GTGTGGCAGGGGCTGGGGTGGGG + Intronic
1104989842 12:132619133-132619155 GCGGGGCAGGGGCTGGGATTGGG + Intronic
1105682581 13:22744700-22744722 CCCTTGCAGGGCATGCGATGGGG + Intergenic
1105705942 13:22967480-22967502 TGGCGGCAGGGCCTGGGTTGGGG + Intergenic
1105858842 13:24392464-24392486 TGGCGGCAGGGCCTGGGTTGGGG + Intergenic
1106111974 13:26785457-26785479 CCCTCGCAGGGCGTGCGATGGGG + Intergenic
1106125587 13:26897893-26897915 CTGGGGCTGGGCCTGGGCTGTGG + Intergenic
1106548666 13:30752552-30752574 CTGTGGGAAGGCCGGGGATGTGG - Intronic
1109151652 13:58856229-58856251 CCCTCGCAGGGCATGCGATGGGG + Intergenic
1109152380 13:58860554-58860576 CCCTCGCAGGGCTTGCGATGGGG + Intergenic
1109651238 13:65330396-65330418 CCCTCGCAGGGCGTGTGATGGGG + Intergenic
1109784602 13:67156898-67156920 CCCCGGCAGGGCATGCGATGTGG - Intronic
1109961692 13:69639508-69639530 ACGTGGTAGGGTCTGGAATGGGG + Intergenic
1111197989 13:84898468-84898490 CCCTCGCAGGGCGTGAGATGGGG + Intergenic
1111262570 13:85760911-85760933 GCCTGGCAGGGCGTGAGATGGGG + Intergenic
1112183915 13:97110471-97110493 CCAAGGAAGGGGCTGGGATGAGG + Intergenic
1112461406 13:99606591-99606613 GCGAGGCGGGGCCTGGGACGGGG + Intergenic
1113616033 13:111681234-111681256 AAGTGGCCGGGGCTGGGATGCGG + Intergenic
1113621501 13:111766127-111766149 AAGTGGCCGGGGCTGGGATGCGG + Intergenic
1113675353 13:112202967-112202989 CCGTGGCAGAGCCGGGTGTGGGG + Intergenic
1113938720 13:114007782-114007804 CTGTGGCAGTGCCGGGGCTGGGG - Intronic
1113994392 14:16054495-16054517 GCGTGGCAGGGCGGGCGATGGGG - Intergenic
1114757005 14:25270471-25270493 CAGTGCCAGGGATTGGGATGTGG + Intergenic
1114777326 14:25498647-25498669 CCAGGGCAGGGGCTGGGGTGGGG + Intergenic
1115123943 14:29970859-29970881 CCCTCGCAGGGCGTGCGATGGGG + Intronic
1116326293 14:43536362-43536384 GGGTGGCAAGGCCTGGGTTGGGG - Intergenic
1118561237 14:67085872-67085894 TGGTGGCAGGTGCTGGGATGAGG - Intronic
1118603505 14:67486871-67486893 CTGTGACAGGACCTTGGATGGGG + Intronic
1118857766 14:69637394-69637416 CTGGTGCAGCGCCTGGGATGTGG + Intronic
1119331335 14:73796262-73796284 CCATACCAGGACCTGGGATGTGG - Intergenic
1119697558 14:76725856-76725878 CCCTTGCAGGGCGTGCGATGGGG + Intergenic
1120840052 14:89077721-89077743 CCGTGGCAGGCCCTTGGACTTGG - Intergenic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121137248 14:91510067-91510089 CGGTGGCAGGGCCAGGTATAAGG - Exonic
1122159601 14:99773759-99773781 CCTGGGCAGGGCCGGGGAGGGGG - Intronic
1122267153 14:100552067-100552089 CCTTGGCAAGGGCTGGGAGGAGG - Intronic
1122297578 14:100713955-100713977 AGGTGGCAGGGTCTGGGATGGGG + Intergenic
1122548482 14:102537964-102537986 CTGGGGCAGGGTCAGGGATGTGG - Intergenic
1122742874 14:103881993-103882015 CCCTGGCAGGGCCAGGAACGGGG - Intergenic
1122918061 14:104867899-104867921 CCCAGGCAGGGCCTGGGGTGAGG - Intronic
1123042277 14:105495335-105495357 CCCTGGGCAGGCCTGGGATGAGG - Intronic
1202930254 14_KI270725v1_random:28697-28719 CCGGGGCAGGGCCAGGGCTGGGG - Intergenic
1123506242 15:20942763-20942785 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1123563468 15:21516467-21516489 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1123599720 15:21953753-21953775 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1124617206 15:31250274-31250296 CCCTGGCAGGGACTGGAATCAGG - Intergenic
1125400941 15:39302113-39302135 GCATCGCAGGGCATGGGATGAGG - Intergenic
1125725648 15:41866924-41866946 CAGTGGAAGGCCCTGGGCTGGGG + Intronic
1125933715 15:43617538-43617560 CCAGGGCTGGGACTGGGATGTGG - Intronic
1125946813 15:43717000-43717022 CCAGGGCTGGGACTGGGATGTGG - Intergenic
1126348267 15:47718463-47718485 CCGGGCCTGGGCCGGGGATGGGG - Intronic
1126475594 15:49062599-49062621 CCCTTGCAGGGCATGTGATGGGG + Intergenic
1127155886 15:56123898-56123920 CCGTGGCAGGTGCTGGGAGATGG + Intronic
1127259303 15:57316743-57316765 CCCTGGCAGGGCCTAGGAGAGGG - Intergenic
1128078310 15:64841820-64841842 CCGGGGCGGGGCCGGGGAGGGGG - Intergenic
1128608906 15:69058407-69058429 CTGAGGCAGGCCCTGGGAAGGGG + Intronic
1128870913 15:71154662-71154684 CTGTGGCAAGGCATGGCATGGGG - Intronic
1129328907 15:74816751-74816773 CTGGGGCAGGGGCTCGGATGGGG - Intronic
1129386886 15:75201310-75201332 CCCTGGAAGGGCCGGGAATGAGG - Intronic
1129884437 15:79028661-79028683 CAGTGGCAGGGTCTGGGGAGTGG + Intronic
1129907437 15:79198536-79198558 CAGTGGCTGGGACTGGGCTGGGG + Intergenic
1130411569 15:83653232-83653254 CCGTGTCCAGGCCTGGGATTTGG - Intergenic
1130648921 15:85751279-85751301 CTGTGGCAGGGACGGGGAGGTGG - Intergenic
1131058635 15:89391119-89391141 CCCTTGCAGGTCCTGGGATGGGG + Intergenic
1131065045 15:89429308-89429330 CATTTGCAAGGCCTGGGATGTGG + Intergenic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1202971826 15_KI270727v1_random:243604-243626 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1132562174 16:600911-600933 CTGTGGCAGAGCCTGGTGTGTGG + Intronic
1132643776 16:989631-989653 CACTGGCAGGGCCTGGGCAGTGG - Intergenic
1132681927 16:1145955-1145977 CCGGGGCTGGGCCTGGGCTGGGG + Intergenic
1132690661 16:1180571-1180593 CCGTGGGGGGGCCAGGGAGGAGG + Intronic
1132698662 16:1212989-1213011 CCGAGGCAGGTCCTGGGGTGTGG + Intronic
1132880404 16:2159551-2159573 CTGAGGCAGGGGCTGGGCTGGGG + Intronic
1133770892 16:8866884-8866906 GCTTGGCGGGGCCTGGGAGGGGG - Intronic
1134132168 16:11657323-11657345 CAGTGGCTGAGCCTGGGCTGGGG + Intergenic
1134338723 16:13325742-13325764 CCTTTGCAGGGCCATGGATGAGG + Intergenic
1134346550 16:13397246-13397268 CCCTGGCAGGGCTTGTAATGGGG + Intergenic
1134384110 16:13756028-13756050 CCGTGCTAGAGGCTGGGATGCGG - Intergenic
1134535943 16:15027231-15027253 CCCTCGCAGGGCATGTGATGGGG + Intronic
1135419954 16:22299082-22299104 ATGTGGTAGGGCCTGGGAGGAGG + Intronic
1136020860 16:27438897-27438919 GCATGGAAGGGCCTGGGAGGTGG + Intronic
1136171822 16:28494541-28494563 CGTGGGCAGGGCCTGGGGTGGGG + Intronic
1136723267 16:32340070-32340092 CCGGGGCAGGGCCAGGGCCGGGG + Intergenic
1136773670 16:32860278-32860300 CCGGGGCAGGGCCAGGGCCGGGG - Intergenic
1136841604 16:33546131-33546153 CCGGGGCAGGGCCAGGGCCGGGG + Intergenic
1136896942 16:34001241-34001263 CCGGGGCAGGGCCAGGGCCGGGG + Intergenic
1136995187 16:35184201-35184223 ACCTGGCAGTGCCTGGGGTGGGG + Intergenic
1137057191 16:35751381-35751403 GCCTGGCAGGGGCTTGGATGTGG + Intergenic
1137541440 16:49364942-49364964 CCTTGTCAGGGGCTGGGGTGCGG - Intergenic
1137673897 16:50294376-50294398 CAGTGATAGGGCCTGGGGTGGGG + Intronic
1138063904 16:53920656-53920678 CAGTGGCAGGGGTTGGCATGAGG + Intronic
1138448999 16:57081689-57081711 AGGCGGCAGGGCCTGGGCTGGGG + Intronic
1138561161 16:57801925-57801947 CCCTGGCAGGGCCTGGGGCGGGG - Intronic
1138808546 16:60121340-60121362 CCCTCGCAGGGCATGCGATGGGG - Intergenic
1139505892 16:67397960-67397982 GCGCGGGAGGGCATGGGATGTGG - Intronic
1139860112 16:70013556-70013578 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1140066756 16:71617801-71617823 TCATGGCAGGGCTTGGAATGGGG - Intergenic
1140614734 16:76648747-76648769 CCCTGGCAGGGCATGCGATGAGG + Intergenic
1141479221 16:84295112-84295134 CCGTGTAAGTGCCTGGGATGGGG + Exonic
1141662443 16:85448733-85448755 GGGTTGCAGGGCCGGGGATGTGG - Intergenic
1141713575 16:85714304-85714326 CTGGGGCAGTGCCTGGGGTGAGG - Intronic
1142112724 16:88340853-88340875 CCGTGAGAGGACTTGGGATGAGG + Intergenic
1142260243 16:89039497-89039519 ACGGGGCAGGGCCTGGCATCAGG - Intergenic
1142449996 16:90168891-90168913 ACGTGGGAGGGGCTGGGGTGAGG - Intergenic
1203003165 16_KI270728v1_random:177695-177717 CCGGGGCAGGGCCAGGGCCGGGG - Intergenic
1203134771 16_KI270728v1_random:1714101-1714123 CCGGGGCAGGGCCAGGGCCGGGG - Intergenic
1203151769 16_KI270728v1_random:1846428-1846450 CCGGGGCAGGGCCAGGGCCGGGG + Intergenic
1142586966 17:979834-979856 GCGTGGCAGGGCGGGGGAAGGGG - Intergenic
1142808908 17:2386179-2386201 CAGTGGCAGGGATTGGGGTGAGG + Exonic
1142977807 17:3656054-3656076 GCATGGCAGGGCCAGGGGTGAGG - Intronic
1143312676 17:6005766-6005788 CCCTGACAGGCCCTGGTATGTGG - Intronic
1143586093 17:7851245-7851267 CAGAGGCAGGTCCTGGGACGGGG + Intronic
1143610778 17:8016306-8016328 CCGCGGCAGGGCGAGGGACGAGG + Intronic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144570102 17:16392034-16392056 GCGGGGCAGGGGCTGGGGTGGGG + Intergenic
1144652803 17:17017998-17018020 TTGTGGCCGGGCCTGGGGTGTGG - Intergenic
1144774602 17:17778919-17778941 CTGGGGCGGGGCCTGGGAAGAGG + Intronic
1145208088 17:20995213-20995235 CCATGGCCTGACCTGGGATGGGG + Intergenic
1145272101 17:21410199-21410221 CCTGGGCAGGGCCTGCCATGAGG + Intronic
1145310309 17:21697661-21697683 CCAGGGCAGGGCCTGGCATGAGG + Intronic
1145362254 17:22221794-22221816 CGGGGGCAGGGGCTGGGGTGGGG + Intergenic
1146277567 17:31525021-31525043 CCGTGCCACAGCCTGGGTTGGGG + Intronic
1146278746 17:31531569-31531591 CAGTGGCTGGGCCTGGGATAGGG - Intronic
1146513783 17:33473183-33473205 CTGGGGCAGGGACTGGCATGGGG + Intronic
1146533906 17:33633436-33633458 TTGTGGCAGGGACTGGGATTGGG - Intronic
1147420963 17:40322000-40322022 CCCTGGCAGGGCTAGGGGTGTGG + Intronic
1147531400 17:41281586-41281608 CCATGACAGGCCCTGGGGTGTGG - Intergenic
1147953753 17:44121262-44121284 CTGCGGCTGGGCCTGGGGTGAGG + Intronic
1148215017 17:45829681-45829703 AGGTGGCAGAGCCGGGGATGGGG + Intronic
1148244987 17:46024713-46024735 CCGAGGCAGGGGCTGGGCAGAGG + Exonic
1148682763 17:49484184-49484206 CCATGGCGGGGGCTGGGGTGGGG + Intergenic
1149367776 17:55963042-55963064 CTGGGGCAGGGCTGGGGATGGGG - Intergenic
1150286780 17:63959228-63959250 CAGGGCCAGGGGCTGGGATGGGG - Intronic
1150641478 17:66952785-66952807 GCCGGGCAGGGCCTGGGATGGGG - Intergenic
1151155761 17:72122257-72122279 CCTTGGCAGGAACTGGGAGGCGG + Intronic
1151444161 17:74152401-74152423 CCAAGGCAGAGCCTGAGATGAGG + Intergenic
1151495098 17:74454134-74454156 CCGGGGCGGGGCTTGGGGTGGGG - Intergenic
1151660256 17:75515112-75515134 CCTTGGCAGTGCCTGGGGTCGGG + Intronic
1151661588 17:75521876-75521898 CCCTGGCCGGGCCAGGGCTGGGG - Exonic
1151717349 17:75837878-75837900 CCGTGGGAGGGCAGAGGATGGGG + Intronic
1151850235 17:76685618-76685640 CAGTGGCCAGGCCAGGGATGCGG + Intronic
1151852728 17:76700660-76700682 CTGTTGCAGGAGCTGGGATGTGG + Intronic
1151930207 17:77227517-77227539 CCGTGGCAGGGGGTGAGAGGAGG - Intergenic
1152335927 17:79700248-79700270 CCACCGCAGGCCCTGGGATGGGG + Intergenic
1152561730 17:81082012-81082034 GTGTGGCAGGGCCTGGGCTCTGG + Intronic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1152800828 17:82329959-82329981 CCATGTCAGGTTCTGGGATGAGG + Intronic
1153863190 18:9234612-9234634 CAGTGGAAGCTCCTGGGATGTGG + Intronic
1153982273 18:10320651-10320673 ACGTGGCAGGTCCAGGGATCTGG + Intergenic
1154163540 18:11997333-11997355 CAGAGGCAGGGCCTGGGCAGTGG + Intronic
1154172566 18:12061914-12061936 CCGTGGCAGGGTTGGGGCTGCGG + Intergenic
1154942933 18:21132625-21132647 GCGGGGCAGGGCTCGGGATGTGG - Intergenic
1155801019 18:30102916-30102938 CTGTGGCAGGTCCTAGAATGGGG + Intergenic
1155994110 18:32311962-32311984 ACATGGCAGGGGCTGGGAAGTGG + Intronic
1156676242 18:39530042-39530064 CCCTGGCAGGGTGTGCGATGGGG - Intergenic
1157728459 18:49983558-49983580 TCCTGGCAGGGGCCGGGATGGGG - Intronic
1157932445 18:51838063-51838085 ACTTGGGAGGGCCTGGGAGGTGG + Intergenic
1158523809 18:58194600-58194622 CCCTGGCAGGGTTTGGGCTGTGG + Intronic
1158959262 18:62574970-62574992 TCGGGGCAGGGCCTGGGGTGTGG - Exonic
1160533367 18:79578042-79578064 CCGTGGCAGGACCAGGAAGGAGG + Intergenic
1160921199 19:1521598-1521620 CTGGGGCAGGGCGGGGGATGGGG + Intergenic
1161038186 19:2096788-2096810 GCGGGGCTGGGCCTGGGATGGGG + Intronic
1161195290 19:2983125-2983147 ACTTAGCAGGGCCTGGGAGGAGG + Intronic
1161312571 19:3603133-3603155 CTGAGGCAGGGCCTGGGCTGTGG + Intronic
1161556603 19:4946187-4946209 CGGTGCCAGGGACTGGGAGGGGG - Intronic
1161588698 19:5118931-5118953 CCCTGGCAGGCCCTGGGGTGTGG + Intronic
1161636960 19:5395102-5395124 CCCTGGAAGGGCCTGGTCTGAGG + Intergenic
1161813166 19:6482125-6482147 CGGTGGGGGGGCCAGGGATGGGG + Intronic
1162502604 19:11062541-11062563 CCGTGGCCCAGCCTGGGTTGGGG + Intronic
1162781128 19:13007504-13007526 CCATGCCAGGGCCTGGGCTTGGG - Intronic
1162792402 19:13069878-13069900 ACGAGGCAGGGCCTGGGGAGGGG + Intronic
1162915662 19:13873218-13873240 AAGGGGCAGGGCCTGGGCTGGGG + Intronic
1163117971 19:15199922-15199944 CCGCGGCTGGGCCGGGGAGGGGG - Intronic
1163385133 19:16995280-16995302 CAGATGCAGGGCCAGGGATGTGG + Intronic
1163569664 19:18073474-18073496 CTGTGGGGTGGCCTGGGATGGGG - Intronic
1164631131 19:29762156-29762178 CCATGCCATGGTCTGGGATGGGG - Intergenic
1164694201 19:30231481-30231503 CCAGGGCAGGGTCTGGGCTGAGG + Intronic
1165295770 19:34925031-34925053 CCCTGGCAGGGCGTGCGATGGGG + Intergenic
1166853632 19:45771735-45771757 CCGGGGCCGGGGCCGGGATGCGG - Intronic
1167071705 19:47226066-47226088 CCGTGCCAGGGGCTGGGGGGCGG + Intronic
1168348041 19:55660356-55660378 CTGGGGCAGGGCCTGGGAAAGGG - Intronic
1202691672 1_KI270712v1_random:98618-98640 CCGTGGCAGGACCAGCAATGGGG + Intergenic
924968557 2:101200-101222 CCCTGGCAGGCCCGGGGGTGCGG + Intergenic
925092774 2:1168497-1168519 CCCTTGCAGGGCTTGTGATGGGG - Intronic
925312162 2:2892537-2892559 CCGAGGCAGGGCCAGGGATCCGG - Intergenic
925438588 2:3863931-3863953 GCATTGCAGGGCCTGGGATAGGG + Intergenic
926125064 2:10266976-10266998 CCCAGGCAGGGCTTGAGATGTGG - Intergenic
926729664 2:16026600-16026622 CCGTGGCCAGGCTGGGGATGAGG + Intergenic
927292613 2:21419851-21419873 CAGGGGTAGGGCCTGGGATAGGG + Intergenic
927864605 2:26580486-26580508 CAGTGACAGGATCTGGGATGGGG + Intergenic
928537862 2:32257752-32257774 CCTTCGCAGGGCTTGCGATGGGG + Intronic
929996555 2:46829642-46829664 CCTTGGGTGGGCATGGGATGTGG - Intronic
930398119 2:50848231-50848253 CCCTCGCAGGGCGTGCGATGGGG - Intronic
931470109 2:62531311-62531333 CCCTCGCAGGGCGTGAGATGAGG + Intergenic
932580290 2:72988961-72988983 CCCAGGCAGGGGCTGGGGTGGGG - Intronic
933954716 2:87355332-87355354 CCGTGGCAGGACCAGCAATGGGG - Intergenic
933969294 2:87457286-87457308 GTGTGGCAGGGCCTGAGATCCGG - Intergenic
934274282 2:91565152-91565174 CCGTGGCAGGACCAGCAATGGGG + Intergenic
934520526 2:95017466-95017488 CCTTGGCAGTGTCTGGCATGAGG - Intergenic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
935547640 2:104417653-104417675 GCGTGGGTGGGCCTGGGCTGAGG + Intergenic
937034439 2:118769295-118769317 CAGAGACAGGGGCTGGGATGAGG - Intergenic
937052246 2:118901992-118902014 CCCTGGGAGGGGCAGGGATGAGG - Intergenic
937125685 2:119473819-119473841 CGGTGGCAGGGCCTGGGATCAGG - Intronic
937127179 2:119482221-119482243 CCGGGCCAGGGCCTGGGTTAGGG + Intronic
937261771 2:120591278-120591300 GGGTGGCAGGACCTGGGCTGGGG - Intergenic
937338676 2:121077190-121077212 CCGCGGAAGGGGCCGGGATGGGG + Intergenic
937438960 2:121901101-121901123 CTGTGGCAGAGGCTGTGATGAGG + Intergenic
937532379 2:122844917-122844939 CAGTGGCAGGTCCTGTGATATGG + Intergenic
937866120 2:126752993-126753015 TCGGGGCAGGGCCAGGGAGGAGG - Intergenic
938305467 2:130251637-130251659 CTGGGGCAGGACCTGGGAGGGGG - Intergenic
938576421 2:132608642-132608664 GCCTGGCAGGGCTTGGCATGTGG + Intronic
939818935 2:146931338-146931360 CCCTTGCAGGGCATGTGATGTGG - Intergenic
941325556 2:164109674-164109696 CCCTGGCAGGGTGTGCGATGGGG - Intergenic
942522437 2:176818731-176818753 CCCTGGCAGGGCCTGAGACACGG - Intergenic
944529513 2:200653403-200653425 CCATGGAAGGACCTGGGCTGGGG + Intronic
944662935 2:201936220-201936242 GAGTGGCAAGGGCTGGGATGAGG + Intergenic
944684131 2:202103140-202103162 CTGAGGGAGAGCCTGGGATGGGG + Intronic
944822039 2:203441014-203441036 CCATGGCAGAGCCTGGGGTTGGG + Exonic
944899014 2:204195668-204195690 CCCTGGAAGGGCCAAGGATGGGG - Intergenic
945175588 2:207040403-207040425 CCTTGGTAGAGGCTGGGATGGGG + Intergenic
946195861 2:218032882-218032904 CAGTGGCAGGGAGAGGGATGGGG - Intergenic
946200307 2:218067696-218067718 CAGTGGCAGGGACAGGGATGGGG - Intronic
946578603 2:221103217-221103239 CCGTGGCAAGTGCTGCGATGGGG + Intergenic
947513555 2:230781564-230781586 GCTTGGCAGGACCTGGAATGTGG + Intronic
947826272 2:233107869-233107891 CCGTGGCAGCGCTGGGGAAGAGG - Intronic
948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG + Intergenic
948422681 2:237870243-237870265 TCGGGGCAGGCCCTGGGATTTGG - Intronic
948438843 2:237972482-237972504 GGGTGCCAGGTCCTGGGATGTGG - Intronic
948663874 2:239522747-239522769 CCCTGGCACTGCCTGGGATCTGG + Intergenic
948696984 2:239737540-239737562 CTGTGGCTGGGGCTGGGCTGGGG - Intergenic
948697026 2:239737634-239737656 CTGTGGCTGGGGCTGGGCTGGGG - Intergenic
948697077 2:239737746-239737768 CCGGGGCTGGGCTGGGGATGGGG - Intergenic
948697089 2:239737769-239737791 CCGGGGCTGGGCTGGGGATGGGG - Intergenic
948697137 2:239737870-239737892 CCGGGGCTGGGCTGGGGATGGGG - Intergenic
948697211 2:239738018-239738040 CCGGGGCTGGGCTGGGGATGGGG - Intergenic
948697233 2:239738059-239738081 CCGGGGCTGGGCTGGGGATGGGG - Intergenic
948697341 2:239738262-239738284 CCGGGGCTGGGCTGGGGATGGGG - Intergenic
948697355 2:239738290-239738312 CTGTGGCTGGGGCTGGGCTGGGG - Intergenic
948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG + Intronic
948855032 2:240726135-240726157 CCGTGGCCAGACCTGGGCTGTGG - Intronic
948869712 2:240791916-240791938 CCAGTGCAGGGCCTGGGATGGGG - Intronic
949021211 2:241742424-241742446 TCGTGGCAGTGCCTGGGATGAGG - Exonic
1168948820 20:1782619-1782641 CCGTGTCTGGGCCTGGGACAGGG - Intergenic
1168954476 20:1825268-1825290 CGGTGGCAGGGCCTGGATTTGGG - Intergenic
1168998704 20:2151074-2151096 CTGTGGCATGGCCTGGAAAGGGG - Intronic
1169029709 20:2397852-2397874 CTGTGGGAGGGCCTGGAATATGG + Intronic
1169194228 20:3674736-3674758 AGGAGGCTGGGCCTGGGATGGGG - Intronic
1169867509 20:10217665-10217687 CCGTGCCCGGGCCCGGGAAGGGG - Intergenic
1170485920 20:16816338-16816360 CCTTCACAGGGCCTGCGATGGGG + Intergenic
1171016264 20:21544676-21544698 TGGAGGCAGGGCCTGGGAGGAGG - Intergenic
1171314231 20:24173911-24173933 TAGTGGCAGGGGGTGGGATGGGG + Intergenic
1172049977 20:32109910-32109932 CAGGGGCAGGGCCAGGGAGGTGG - Intronic
1172634687 20:36402005-36402027 CAGTGGCAGGGCCAGGGTTGGGG + Intronic
1172654012 20:36525873-36525895 CCCTGCCAGGTCCTGGGCTGTGG - Exonic
1172699632 20:36845290-36845312 CTGTGTCAGGCCCTGGCATGGGG - Intronic
1172765492 20:37348553-37348575 AGGTGGCAGGGCCTGAGCTGAGG + Intronic
1172949427 20:38713209-38713231 TCTTGGCAGGGGCTGGAATGAGG + Intergenic
1174069077 20:47887428-47887450 CCCTGGCAAGGCCTGTGATGTGG + Intergenic
1174417237 20:50375601-50375623 CCTCGGCTGGGCCAGGGATGGGG + Intergenic
1174749744 20:53100019-53100041 CAGTGCCAGGGGCTGGGCTGAGG + Intronic
1175074364 20:56360427-56360449 CAGTGCCAGGGCCTGAGCTGGGG - Intronic
1175107851 20:56627335-56627357 GAGAGCCAGGGCCTGGGATGGGG + Intergenic
1175314744 20:58039543-58039565 CCCAGGGAGGGCCTGGGAAGAGG + Intergenic
1175688191 20:61046413-61046435 CCCAGGCAGGGGCTGGGATCAGG + Intergenic
1175989179 20:62779033-62779055 TCCTGGCTGGGGCTGGGATGCGG - Intergenic
1176071750 20:63230545-63230567 CCCTTGCAGGGCCTGCGATGGGG + Intergenic
1176132620 20:63502728-63502750 CCGTGGCTGGCCCTGGTCTGTGG - Intergenic
1176223551 20:63981300-63981322 CCGGGGCTGGGCCGGGGGTGAGG + Exonic
1176592266 21:8657279-8657301 CCGGGGCAGGGCCAGGGCTGGGG - Intergenic
1179171230 21:38974542-38974564 CCTTGCCAGGGCCTGGGACCTGG - Intergenic
1179507472 21:41851485-41851507 CCCTGGCAGGGTCAGGGAGGAGG + Intronic
1179553903 21:42160412-42160434 CCGTGGCAGGGGCTGGGTAGGGG + Intergenic
1179631987 21:42684395-42684417 GCGTGGCAGAGCCTGGGCTGGGG - Intronic
1179931303 21:44572630-44572652 CAATGGCAGAACCTGGGATGAGG - Intronic
1180163111 21:46006813-46006835 GCCTGGCAGGGGCTGGGAGGAGG + Intergenic
1180261706 21:46674787-46674809 CCCTGGCAGGCCCAGGGGTGCGG - Intergenic
1180275117 22:10634408-10634430 CCGGGGCAGGGCCAGGGCTGGGG - Intergenic
1180312700 22:11252909-11252931 GCGTGGCAGGGCGGGCGATGGGG + Intergenic
1180637124 22:17270090-17270112 CCATGGCAGGGCTGGGGAGGTGG + Intergenic
1180892028 22:19296382-19296404 CCCTTGCAGGGCATGCGATGGGG + Intergenic
1180942421 22:19668003-19668025 CCCTCGCAGGGCGTGCGATGGGG - Intergenic
1181432082 22:22887882-22887904 CCCTGGAAGGGCCTGGGCTAGGG + Exonic
1181769470 22:25114860-25114882 CCGTGGCTGGGGCTGGGAGGGGG + Intronic
1182012534 22:27012428-27012450 GCGGGGCAGGGCAGGGGATGTGG + Intergenic
1182093500 22:27611611-27611633 CTCTGCCAGGGCCTGGGATTGGG - Intergenic
1182578443 22:31289674-31289696 GGCTGGCAGGGCCTGGGAGGTGG + Exonic
1182686041 22:32122297-32122319 CCGTGGCTGGGGGTGGGTTGGGG + Intergenic
1183188084 22:36303947-36303969 GCGTGGCAAGGCCTGGCATGCGG + Intronic
1183315627 22:37135522-37135544 GCGTGGCAGGGCCCTGGATGGGG - Intronic
1183614773 22:38937266-38937288 CCGTGGGAAGCCCTGGGCTGGGG - Intergenic
1183697214 22:39430241-39430263 CCCAAGCAGGGCCTGGCATGGGG + Exonic
1183990987 22:41597013-41597035 CCAGGGCAGGGCCTGGCATGGGG - Intergenic
1184118262 22:42434398-42434420 CCCAGGCAGGCCCTGGGCTGTGG + Intergenic
1184130662 22:42514832-42514854 GCCTGGCAGGCCCTGGGGTGGGG - Intronic
1184140841 22:42576662-42576684 GCCTGGCAGGCCCTGGGGTGGGG - Intergenic
1184201852 22:42974984-42975006 CTGTGCCAGGGCCTAGAATGTGG + Intronic
1184534293 22:45076243-45076265 GCCTGTCAGGGCCTGGGATGGGG + Intergenic
1184545216 22:45163220-45163242 GAGTGACAGGGCCAGGGATGAGG + Intergenic
1184609519 22:45593874-45593896 GCCTGCCAGGGCCTGGGTTGGGG + Intronic
1184688627 22:46107524-46107546 CCGGGGCAGCGCCCGGGAGGTGG + Intronic
1184715131 22:46277678-46277700 CCTGGGCTGGGCCTGGGCTGAGG + Intronic
1184943295 22:47784009-47784031 ACGTGGCAGGGCCCTGGAGGTGG + Intergenic
1184986760 22:48141121-48141143 CACTGGCAGGGCCTGGAATGAGG + Intergenic
1185266379 22:49906438-49906460 CCGTGGCCGTGCCTGGGTTGGGG - Intronic
1185344230 22:50304419-50304441 CTGTGTCAGGGCCTGGCTTGAGG + Intronic
949828254 3:8185698-8185720 CCCTTGCAGGGCGTGTGATGGGG + Intergenic
950110789 3:10417306-10417328 CAGTGGCAGGGGCTGGGCAGAGG + Intronic
950703939 3:14768551-14768573 ACCTGGCAGGGACTGGGTTGGGG + Intronic
953422023 3:42761559-42761581 CTGTAGCAGGGCCTGGTATATGG + Intronic
953896668 3:46808509-46808531 CTCTGGCAGAGCCAGGGATGAGG - Intronic
954301402 3:49702555-49702577 CTCAGGCAGGGCCTTGGATGAGG + Intronic
954630232 3:52044057-52044079 CCCAGGCAGGGCCAGGCATGAGG + Intergenic
954689796 3:52389611-52389633 CCCAGGCAGGGCCTGTGGTGTGG + Intronic
954690588 3:52393529-52393551 CTGTGGCAGGGCCTGAGAACAGG + Intronic
954800265 3:53183219-53183241 CCGGGGCAGGGCTGGGGATCTGG + Intronic
954922410 3:54203252-54203274 CCCTCGCAGGGCGTGCGATGGGG + Intronic
955387712 3:58492362-58492384 CCGCGGCGGGGCCTGGGCGGGGG + Intronic
955480631 3:59385778-59385800 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
957040606 3:75332858-75332880 CTGTGGCAGCTCCTGGGATGGGG - Intergenic
957895882 3:86421054-86421076 CCGTCACAGGCCCTGGGACGGGG - Intergenic
957895887 3:86421056-86421078 CCGTCCCAGGGCCTGTGACGGGG + Intergenic
957916660 3:86695217-86695239 GGGTGGCAAGGCCTGGGTTGGGG + Intergenic
957991108 3:87628220-87628242 CCCTCGCAGGGCATGTGATGGGG - Intergenic
959583067 3:108001697-108001719 CCCTGGCAGGGCTTGAGAAGTGG - Intergenic
959583503 3:108004815-108004837 CCCTCGCAGGGCATGTGATGGGG - Intergenic
961028862 3:123584958-123584980 CGGTGGCAGGGCCGGGGCCGGGG - Exonic
961045393 3:123704419-123704441 CTGTGGCAGCTCCTGGGATGGGG - Intronic
961075100 3:123975188-123975210 CAGTGGCAGGGGTTGGGAGGAGG - Intronic
961308595 3:125977334-125977356 CAGTGGCAGGGGTTGGGAGGAGG + Intronic
961429179 3:126868258-126868280 CAGTGGCAGAGCCTGGGCTGAGG + Intronic
962821790 3:139055386-139055408 CAGTGGGAGCTCCTGGGATGTGG + Intronic
962891159 3:139674163-139674185 GGGTGGAAGTGCCTGGGATGAGG - Intronic
963374490 3:144446552-144446574 CAGTGGTAGCCCCTGGGATGTGG - Intergenic
965355785 3:167671452-167671474 CCATGGCGGGGCATGGGGTGGGG - Intergenic
965433084 3:168612945-168612967 CCCTGGCAGGGCGTGCGATGGGG - Intergenic
965730080 3:171762418-171762440 AAGTGTCAGGGGCTGGGATGGGG + Intronic
966917302 3:184592156-184592178 ACATGGCAGGGTCTGGGCTGTGG - Intronic
967891435 3:194366964-194366986 GCCTGGCAGGGCCTGGGATTGGG + Intronic
968084690 3:195869053-195869075 CCGTGACAGGGGCGGGGATGAGG - Intronic
968494015 4:905549-905571 CCGTAGCATGGCCTGGGGCGTGG - Intronic
968494035 4:905634-905656 CCGTGGCATGGCCTGGGGCGTGG - Intronic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
968620557 4:1601775-1601797 CTATGGCAGGGCCTGGCACGTGG + Intergenic
968843966 4:3029524-3029546 CAGGGGCAGGGCCTGGGAGGTGG - Intronic
969463227 4:7339888-7339910 GCTTGGCAGAGCCTGGGTTGGGG - Intronic
969597648 4:8158219-8158241 CTCTGGCAGCGCCTGGGTTGGGG - Intronic
969659000 4:8515526-8515548 CAGGGGCAGGGCCAGGGCTGTGG + Intergenic
969722320 4:8899165-8899187 CCCTGGCAGGGACTCGGGTGCGG + Intergenic
969961780 4:10952015-10952037 CCCTGCCATGGCCTGGGAGGTGG - Intergenic
970574193 4:17411671-17411693 CCGTTGCAGGGCATGCAATGGGG + Intergenic
972203582 4:36745333-36745355 CCTTGGCAGGGACATGGATGGGG + Intergenic
972670962 4:41214040-41214062 GCTTGGCAGGGCCTGGGGCGGGG - Intronic
972705115 4:41534777-41534799 CATTGGCAGGGACTGGGATATGG + Intronic
972940270 4:44186699-44186721 CCCTGGCAGGGCATGTGATGCGG - Intronic
973581631 4:52349641-52349663 CCGGGGCAGGGGGTGGGAGGTGG + Intergenic
973936246 4:55849859-55849881 CCATCGCAGGGCATGCGATGGGG + Intergenic
974669654 4:65013796-65013818 CCCTTGCAGGGCATGCGATGGGG + Intergenic
975242854 4:72082001-72082023 CCTTGTCAGGGAGTGGGATGAGG + Intronic
976109866 4:81660689-81660711 GTGTGGCAGAACCTGGGATGTGG - Intronic
976877324 4:89869906-89869928 CCTTGCCAGGGCGTGCGATGGGG - Intergenic
979189179 4:117835292-117835314 CCCTTGCAGGTCCTGCGATGAGG + Intergenic
979515881 4:121609544-121609566 CCCTGGAAGCACCTGGGATGAGG - Intergenic
980107586 4:128602292-128602314 CTGTGGTGGGGCCTGGAATGAGG + Intergenic
981085434 4:140678466-140678488 AGGTGGCAGGGCATGGGATGAGG - Intronic
983145906 4:164214883-164214905 CCCTTGCAGGGCGTGCGATGGGG + Intronic
984261301 4:177445685-177445707 CCCTTGCAGGGCGTGTGATGGGG - Intergenic
984263543 4:177470430-177470452 CCCTCGCAGGGCGTGCGATGGGG + Intergenic
985358717 4:189148861-189148883 CCCAGGCAGAGCCTGTGATGAGG + Intergenic
985784024 5:1884978-1885000 CCGGGCCAAGGGCTGGGATGGGG + Intronic
985837857 5:2283673-2283695 CCGAGGCTGAGCCTGGGTTGGGG + Intergenic
986779608 5:11052639-11052661 CTTTGGCAGTGCCTGGGAGGAGG - Intronic
988152283 5:27399797-27399819 CCGGGGCCTGTCCTGGGATGGGG + Intergenic
988816424 5:34839171-34839193 CCTTGGCCGGACCTGGGCTGCGG + Exonic
990585482 5:57207374-57207396 CCTTTGCAGGGCATGTGATGGGG + Intronic
991196430 5:63939469-63939491 CCCTCGCAGGGCATGTGATGGGG - Intergenic
992093669 5:73340749-73340771 CCCTTGCAGGGCGTGTGATGGGG - Intergenic
994886184 5:105564460-105564482 CCCTTGCAGGGCGTGCGATGGGG - Intergenic
995969619 5:117952377-117952399 CAGTGACAGGGACTGGCATGAGG + Intergenic
996185010 5:120464406-120464428 CCGTAGCAGCGCCAGGGACGGGG + Exonic
996549204 5:124712296-124712318 CAGTGTCATGGCCTGGGATGGGG + Intronic
997528954 5:134570573-134570595 AGGTGGCAGGCTCTGGGATGTGG - Intronic
997530638 5:134579329-134579351 CCAGGGCAGGGCCTGGGACAGGG - Exonic
997697817 5:135875167-135875189 ATCTGGCAGGGCCTGGGGTGGGG - Intronic
999083225 5:148863860-148863882 ATGTGGCAGTTCCTGGGATGTGG - Intergenic
999109696 5:149108037-149108059 CCATGGCAGGCCCTGGTGTGTGG - Intergenic
999115607 5:149160883-149160905 CCACTGCTGGGCCTGGGATGAGG - Intronic
999194625 5:149773696-149773718 CCGCGGGAGGGACTGAGATGGGG + Intronic
999321500 5:150618301-150618323 CTGGGCCAGGGCCTGGGCTGGGG - Exonic
1001694363 5:173659111-173659133 CCTAGGCAGGGCCTTGGAAGGGG - Intergenic
1001940177 5:175734690-175734712 CCGTCGCAGGGCGTGCAATGTGG - Intergenic
1001950347 5:175812247-175812269 GGTGGGCAGGGCCTGGGATGGGG - Intronic
1002173965 5:177391098-177391120 CCCTGCCTGGGCCTGGGGTGGGG - Intronic
1002439674 5:179257813-179257835 CCGGGGCAGTGGCCGGGATGGGG - Intronic
1002475289 5:179461758-179461780 CCATGCCAGGTGCTGGGATGTGG - Intergenic
1003161050 6:3634677-3634699 CGTTGCCAGGGGCTGGGATGAGG + Intergenic
1003330211 6:5123232-5123254 CCGAGGCTGGGGTTGGGATGAGG - Intronic
1003623919 6:7726414-7726436 CCGTTGCAGGGCCCAGGCTGCGG - Intergenic
1003711011 6:8590168-8590190 TCAGGGCAGGGCCTGGGATCGGG + Intergenic
1005243402 6:23855718-23855740 ACGGGGCAGGGCCTGGGTAGAGG - Intergenic
1005794701 6:29347610-29347632 CCCTCGCAGGGCATGCGATGGGG + Intergenic
1005989123 6:30892367-30892389 CCCTGCCATGGCCTGGGAGGGGG + Exonic
1006180284 6:32150147-32150169 CAGAGTCAGGGCCTGGGAGGGGG - Intronic
1006286120 6:33095923-33095945 CCTGTGCAGGGCCTGGGAAGAGG - Intergenic
1006513591 6:34534259-34534281 CTCTGGCAGGGCCTGAGCTGGGG + Exonic
1006639683 6:35483542-35483564 CAGTGCCAGGGCCTGGGATGAGG - Intronic
1006647186 6:35522876-35522898 CGGTGGGAGGGCCTGGGGTTCGG - Intergenic
1007246824 6:40469159-40469181 CCGAGGCAGGGGTTGGAATGAGG + Intronic
1007470741 6:42088644-42088666 CCCTGGCAGGGCATGGGCTGAGG - Intergenic
1007578737 6:42942601-42942623 CTGGGCCAGGGCCTGGGATTGGG - Intergenic
1007843658 6:44736841-44736863 GACTGCCAGGGCCTGGGATGAGG + Intergenic
1011873455 6:91926517-91926539 CCCTAGCAGGGCGTGCGATGGGG + Intergenic
1012330537 6:97979574-97979596 CCCTCGCAGGGCGTGCGATGTGG - Intergenic
1012440259 6:99255543-99255565 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1012744297 6:103064785-103064807 CCGGGGCCTGTCCTGGGATGGGG - Intergenic
1013113077 6:107079616-107079638 CCCTTGCAGGGCATGCGATGGGG - Intronic
1013305595 6:108844322-108844344 CTCTGCCAGGGCCTGGTATGTGG + Intergenic
1014225374 6:118840979-118841001 CCAAGGCAGGGGCAGGGATGGGG - Intronic
1016429060 6:143964089-143964111 CCTTATCAGGCCCTGGGATGGGG - Intronic
1017339246 6:153301766-153301788 CCCTGGCAGGGCGTGCGATGGGG + Intergenic
1018788550 6:167128248-167128270 CTGTGTCAGGGCCTGGGCAGGGG + Intronic
1018899707 6:168044889-168044911 ACGTTGCAGGGCCTGGGTTTCGG + Exonic
1018973622 6:168546712-168546734 GCTTGGCAGGGACTGGGGTGGGG - Intronic
1019138417 6:169927152-169927174 CCCTGGCAGGGGCCGGGCTGAGG + Intergenic
1019271902 7:154191-154213 CCCTGGCAGGGACTGGCAGGAGG - Intergenic
1019277708 7:184619-184641 CTGTGGGAGGGGCTGGGCTGAGG - Intergenic
1019288335 7:234788-234810 CAGAGGGAGGGCCTGGGCTGGGG - Intronic
1019556828 7:1636037-1636059 CCTTTGAAGGGACTGGGATGGGG + Intergenic
1019708028 7:2505638-2505660 CCGTGAGTGGGCCTGGCATGAGG + Intergenic
1019712778 7:2525026-2525048 CCCTGGAAGGGGCTGGGCTGCGG + Intronic
1019732170 7:2634375-2634397 CAGTGGGTGGGCCTGGGCTGTGG + Intronic
1019771069 7:2883787-2883809 CCGTGGCAGGGCCTGTGGCGGGG + Intergenic
1021695105 7:23268850-23268872 ATGGGGCGGGGCCTGGGATGGGG - Intronic
1022010515 7:26304512-26304534 TGGTGGCAGGGCCAGGGGTGTGG + Intronic
1023841751 7:44102083-44102105 CCGTGGCAGAGCCTGGGCACAGG + Intergenic
1023990862 7:45127467-45127489 CCCAGGAAGGGCCTGGGTTGAGG - Intergenic
1024230306 7:47358670-47358692 TCATGCCAGGACCTGGGATGAGG - Intronic
1024674215 7:51623654-51623676 CAGTGGAAGGGCCTGGGTTATGG + Intergenic
1025077019 7:55952144-55952166 CCGTCGCTGGGCCGGGGAGGGGG + Intronic
1025253399 7:57366937-57366959 CCTTGGCTGGGCTAGGGATGGGG - Intergenic
1026111009 7:67458940-67458962 CCCCGGTAGGGCCTGTGATGGGG + Intergenic
1026331087 7:69353270-69353292 GCGTGGAAGGGCATGGGCTGAGG - Intergenic
1026857840 7:73766723-73766745 GCGTGGCAGGGGTTGGGGTGAGG - Intergenic
1027932327 7:84553136-84553158 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1028011845 7:85655476-85655498 TCGGGGCAGTGACTGGGATGGGG - Intergenic
1029111185 7:98213745-98213767 CGGTGGCAGGGGCTGGGTGGGGG - Intergenic
1029207637 7:98878884-98878906 CCGTAGCTCGGCCTGGGACGCGG + Intronic
1029380441 7:100210964-100210986 CTGTCGCAGGCCCTGGGCTGTGG + Intronic
1029437985 7:100573318-100573340 CAGTGGCCGGGCCTGGCAGGTGG + Exonic
1030101850 7:105953555-105953577 CCATTGCAGGGCGTGCGATGAGG - Intronic
1030115411 7:106058942-106058964 CCCTGGCAGATCCTGGCATGTGG + Intergenic
1031645626 7:124221878-124221900 CCGTGAAAGCCCCTGGGATGGGG + Intergenic
1033069361 7:138188025-138188047 GAGTTGCAGGGCCTGGGTTGAGG + Intergenic
1033229072 7:139582744-139582766 TCATGGCATTGCCTGGGATGGGG - Intronic
1033442232 7:141390512-141390534 CCCTGGAAGGGCTGGGGATGAGG - Intronic
1034264444 7:149774083-149774105 CCGGGGGAGGGTCTGGGAGGGGG + Intergenic
1034437428 7:151069878-151069900 CAGTGGCAGGAGATGGGATGGGG - Intronic
1035758365 8:2051008-2051030 CCGTGGCAGGACCTGGGCACGGG - Intronic
1036127369 8:6075319-6075341 CCTTTGCAGGGACAGGGATGAGG - Intergenic
1036480375 8:9133976-9133998 CCGGGGCTGGGCCTTGGATTTGG - Intergenic
1036601820 8:10267932-10267954 CCGCCTCAGGGTCTGGGATGGGG - Intronic
1036681405 8:10877195-10877217 CCATGCCAGGGCCTGGGAACTGG - Intergenic
1037149339 8:15616853-15616875 CTGTGGCTGGGCCAGGCATGCGG - Intronic
1037562317 8:20086061-20086083 CACTGGGAGGGTCTGGGATGGGG + Intergenic
1037884744 8:22590009-22590031 CGGTGGCAGGGCCTGGGGCTGGG + Intronic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1039865623 8:41499134-41499156 CCCTCGCAGGGCGTGTGATGGGG + Intronic
1039953154 8:42187803-42187825 CGATGGCAGGGCCAGGGGTGGGG - Intronic
1040782174 8:51122168-51122190 CCCTCGCAGGGCATGCGATGGGG - Intergenic
1041292471 8:56320189-56320211 CCGCGGCAGCGCCAGGGGTGGGG + Exonic
1042676252 8:71325470-71325492 ACCTGACAGGGCCTGGTATGTGG + Intronic
1046250409 8:111623876-111623898 CCCTCGCAGGGCATGCGATGGGG + Intergenic
1047438917 8:124858947-124858969 CTGTCACAGGGCCTGGCATGCGG + Intergenic
1048780121 8:137990834-137990856 GGGTGGCAAGGCCTGGGTTGGGG - Intergenic
1049190493 8:141284877-141284899 CCGTGGCAGGGACAGGGGCGGGG - Intronic
1049361580 8:142214618-142214640 CCGTAGCAGGGGCTGGAATGAGG - Intronic
1049408377 8:142461655-142461677 AGCTGCCAGGGCCTGGGATGAGG + Intronic
1049446670 8:142634531-142634553 CTGTGGCAGGGGCTAGGGTGGGG - Intergenic
1049446685 8:142634564-142634586 CCCTGGCAGGGGCTGGGGTGGGG - Intergenic
1049562847 8:143320716-143320738 CGGAGGCAGAGACTGGGATGAGG + Intronic
1049608276 8:143540017-143540039 CGGGGGCAGGGCCTGTGGTGGGG - Intronic
1049675903 8:143888902-143888924 TCGGGGCAGGGCCTGGGAGGGGG + Intergenic
1051488491 9:17634848-17634870 CTGTGGCAGGGCCCTGGATGGGG + Intronic
1053691637 9:40589917-40589939 CCGGGGCAGGGCCAGGGCCGGGG - Intergenic
1054273165 9:63047568-63047590 CCGGGGCAGGGCCAGGGCCGGGG + Intergenic
1054302893 9:63390883-63390905 CCGGGGCAGGGCCAGGGCCGGGG - Intergenic
1054401674 9:64717399-64717421 CCGGGGCAGGGCCAGGGCCGGGG - Intergenic
1054435277 9:65201708-65201730 CCGGGGCAGGGCCAGGGCCGGGG - Intergenic
1054495113 9:65819973-65819995 CCGGGGCAGGGCCAGGGCCGGGG + Intergenic
1055734511 9:79312895-79312917 CCTTCGCAGGGCATGCGATGGGG - Intergenic
1056327420 9:85491276-85491298 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1056573226 9:87834445-87834467 CCCTCGCAGGGCATGTGATGGGG + Intergenic
1057200047 9:93134875-93134897 CTGTGGCAGGGGGTGGGCTGGGG + Intergenic
1057278887 9:93696593-93696615 CCAGGGCAGGGGATGGGATGGGG + Intergenic
1057306670 9:93916452-93916474 GCGTGGTAGGGCCTGTGGTGAGG - Intergenic
1057678323 9:97153308-97153330 CCGTCCCAGGGCCCAGGATGAGG + Intergenic
1057797533 9:98169446-98169468 CCTTGGCATGGCCTGGGAGAGGG - Intronic
1058311870 9:103514492-103514514 CCCTTGCAGGGCATGCGATGAGG + Intergenic
1058353663 9:104057088-104057110 CCTTTGCAGGGCCATGGATGAGG + Intergenic
1058400593 9:104614195-104614217 CCCTGGCAGAGCATGTGATGGGG + Intergenic
1059061547 9:111038722-111038744 TGGTGGCAGGGCCGGGGCTGGGG + Intergenic
1060156131 9:121321035-121321057 CTGGGGCAGGGCATGGTATGAGG + Intronic
1060242555 9:121917025-121917047 CCCTGGCAGGGCCTTGGACTGGG - Intronic
1060561513 9:124548903-124548925 CCATGGCAGGAAGTGGGATGGGG - Intronic
1060827144 9:126693824-126693846 CCGGGGCAGGGCCTGGGCCAGGG + Exonic
1060939310 9:127534581-127534603 CTGAGGCAGGGCCCGGGGTGTGG - Intronic
1061306394 9:129735597-129735619 CCGTGGGAGGGCAGGGGGTGTGG - Intergenic
1061309293 9:129751930-129751952 CCTTGGCTGGTCCTGGGATATGG - Intronic
1061480494 9:130895643-130895665 CCTGGGCAGGGCCTGAGCTGGGG + Intergenic
1061680654 9:132241160-132241182 ACGGGGCAGGGCCGGGGAAGTGG + Intronic
1061899218 9:133664455-133664477 CCGAGCCAGGGTGTGGGATGGGG - Intronic
1061904186 9:133688252-133688274 CCGGGAAAGGGACTGGGATGCGG - Intronic
1061942407 9:133890856-133890878 CTATGGCACTGCCTGGGATGTGG + Intronic
1062091001 9:134678845-134678867 CCAAGGCAGAGCCTGGGAAGAGG + Intronic
1062094050 9:134694029-134694051 CCACGGCAAGGCCTGGGCTGTGG + Intronic
1062129847 9:134886340-134886362 CTGGGGCAGGGCCTGGAAGGAGG - Intronic
1062288810 9:135785592-135785614 CCTTGGTGGGGCCTGGGAGGGGG - Intronic
1062289940 9:135789947-135789969 CAGTGCCAGGGCCTGGGTTGTGG - Intronic
1062462407 9:136667422-136667444 CTGTGGCAATGCCGGGGATGGGG - Intronic
1062547085 9:137068762-137068784 CTGTGGCCGGGCCTGGGGTTTGG - Intronic
1062637307 9:137498367-137498389 CACTGGCAGGGGCTGGGACGGGG + Intronic
1062684808 9:137806312-137806334 GCGTGGCAGGGACAGGGATGGGG - Intronic
1203622320 Un_KI270749v1:136126-136148 CCGGGGCAGGGCCAGGGCTGGGG - Intergenic
1186770965 X:12817871-12817893 GCTTGGCAGGGCCTGGGGGGAGG + Intronic
1187341367 X:18425037-18425059 CCGTGCCGGGGGCTGGGGTGGGG - Intergenic
1187392359 X:18894486-18894508 CCGTAGCAGTGCCTGGGCTCGGG + Intronic
1187931286 X:24295693-24295715 CAGAGGCAGGGACTGGGAAGGGG - Intergenic
1187936422 X:24340660-24340682 CCGAGGCAGGGGATAGGATGAGG + Intergenic
1189642207 X:43085430-43085452 CCCTTGCAAGGCCTGTGATGGGG + Intergenic
1189833293 X:44996942-44996964 CCCTCGCAGGGCATGTGATGGGG + Intronic
1190289520 X:48983081-48983103 CCGTGTCCGGGCCTGGGATGGGG + Exonic
1190641040 X:52482843-52482865 CAGTGACAGGGCATGGGATGAGG + Intergenic
1190646632 X:52530022-52530044 CAGTGACAGGGCATGGGATGAGG - Intergenic
1190741502 X:53291838-53291860 ATGGGGCAGGGCCTGGGGTGGGG - Intronic
1192625871 X:72728058-72728080 CCGGCGCAAGGCCTGGAATGTGG + Intergenic
1193510993 X:82399806-82399828 CCGTCACAGGGCATGTGATGGGG + Intergenic
1194748965 X:97662866-97662888 CCATGCCTGAGCCTGGGATGAGG - Intergenic
1194932184 X:99901546-99901568 CTGTTGCAGGGCCTGGGGGGTGG - Intergenic
1195671640 X:107474878-107474900 CCCTGGCAGGGCTGGTGATGGGG + Intergenic
1196072360 X:111539694-111539716 CCCTCGCAGGGCATGTGATGGGG - Intergenic
1198128549 X:133671809-133671831 CCGGGGCCTGGCGTGGGATGGGG - Intronic
1198788148 X:140313687-140313709 CAGAGGTAGGGCCTGGAATGGGG - Intergenic
1199324153 X:146476955-146476977 CAGGGTCAGGGGCTGGGATGGGG + Intergenic
1199544212 X:148990324-148990346 CCGTGTCAGGGGGTGGGGTGAGG - Intronic
1202583286 Y:26403278-26403300 CTGGGGCAGGGCCAGGGCTGGGG + Intergenic