ID: 948725854

View in Genome Browser
Species Human (GRCh38)
Location 2:239933453-239933475
Sequence CAGCCTACAGCAGTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948725854_948725860 5 Left 948725854 2:239933453-239933475 CCTGCCACCACTGCTGTAGGCTG 0: 1
1: 0
2: 2
3: 55
4: 317
Right 948725860 2:239933481-239933503 GCCAAGCCACGGAGCCTCCATGG 0: 1
1: 0
2: 0
3: 9
4: 175
948725854_948725859 -6 Left 948725854 2:239933453-239933475 CCTGCCACCACTGCTGTAGGCTG 0: 1
1: 0
2: 2
3: 55
4: 317
Right 948725859 2:239933470-239933492 AGGCTGGGACAGCCAAGCCACGG 0: 1
1: 0
2: 7
3: 36
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948725854 Original CRISPR CAGCCTACAGCAGTGGTGGC AGG (reversed) Intronic
900435317 1:2628344-2628366 CAGCCTCCCGCAGGGGTGGAGGG + Intronic
904679128 1:32216540-32216562 CAGGCCACAGTAATGGTGGCTGG + Exonic
905937002 1:41832653-41832675 CAGCACAAAGCAGTGGTGCCTGG + Intronic
906703457 1:47876687-47876709 CAGCCTCCAGCAGTGCTGGGAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907829167 1:58048074-58048096 CAGCCAAACACAGTGGTGGCAGG - Intronic
908070667 1:60455791-60455813 GTGACTACAGTAGTGGTGGCAGG - Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909850088 1:80450975-80450997 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
911699915 1:100940909-100940931 CAGCCAAGCACAGTGGTGGCAGG - Intronic
913132730 1:115856801-115856823 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
914241623 1:145856765-145856787 GAGCCTACAGGAGAGGTGCCAGG + Exonic
915092024 1:153433188-153433210 GATCCTACAGCAGTAGAGGCAGG + Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
918206582 1:182314952-182314974 CATCCCACAGCAATGGGGGCAGG + Intergenic
918951491 1:191145919-191145941 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
920016358 1:202912810-202912832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
920603995 1:207362090-207362112 CAGCCTATTCCAGTGGTGGCTGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920806137 1:209235664-209235686 CAGTCTAAACCAGTTGTGGCTGG - Intergenic
922503031 1:226110562-226110584 CTGCCTTCCCCAGTGGTGGCGGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923181752 1:231526896-231526918 CAGGCTAGGGGAGTGGTGGCTGG + Intergenic
924132097 1:240920691-240920713 CAGCCAAGCACAGTGGTGGCAGG + Intronic
924205511 1:241707656-241707678 CAGCCTATCGCAGTGGTCCCTGG - Intronic
1062886568 10:1021059-1021081 AAGCCCACAGCCGTGGAGGCTGG - Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066454904 10:35564583-35564605 CAGCGTTCAGCAGAGTTGGCAGG + Intronic
1067046205 10:42986428-42986450 CATCCTTCAACAGTGGTGACAGG - Intergenic
1067455509 10:46416496-46416518 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1067631695 10:47968139-47968161 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1075907091 10:126090990-126091012 AAGCCTCCATCAGTGGTGGGAGG + Intronic
1075918546 10:126190532-126190554 CAGCCTCCAGCACAGCTGGCTGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077651016 11:3972700-3972722 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1077803933 11:5571146-5571168 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1078769577 11:14336035-14336057 CACCCCACTGCAGTGGTGTCAGG + Intronic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079621974 11:22566655-22566677 TACCCTACAGTAGTGGTGGAGGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081867552 11:46367832-46367854 CGGCCCACAGCAGGGGTGCCAGG - Intronic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1084599679 11:70137426-70137448 CAGCAGACAGCGGTGATGGCGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085161966 11:74355810-74355832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1086439959 11:86818961-86818983 CATCCTACTGGAGTGGTGCCAGG + Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088606580 11:111539546-111539568 CAGCTAACAGCGGTTGTGGCAGG - Intergenic
1088708196 11:112482586-112482608 CTGCTTACAGCAGTGTAGGCAGG + Intergenic
1089344132 11:117779175-117779197 CAGCCCACTGCAATGGTGCCAGG - Intronic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1094486617 12:30930437-30930459 CAGCCAGCAGCAAGGGTGGCCGG + Intronic
1094713160 12:32985750-32985772 CAGGCCCCAGCAGCGGTGGCAGG - Intergenic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095924786 12:47567531-47567553 CAGCATTCAGCAGCGGAGGCAGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096826735 12:54284623-54284645 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1097103310 12:56604637-56604659 CAGCCTTCTGCTGGGGTGGCTGG + Exonic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097743481 12:63272421-63272443 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100256113 12:92884782-92884804 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1101502526 12:105317322-105317344 CAGACTCCAGCTGTGGTGCCTGG - Intronic
1101557190 12:105821440-105821462 CAGCCTAGAGGAGTGGAGGAAGG - Intergenic
1101716797 12:107319188-107319210 CAGCCGCGAGCAGTGCTGGCCGG - Exonic
1102615984 12:114154570-114154592 CAGCCTGCAGGAGTAGTGTCTGG + Intergenic
1103281156 12:119759105-119759127 GAGTCTAGAGCAATGGTGGCTGG - Intronic
1103708972 12:122896805-122896827 CTTCCTACAGGAATGGTGGCTGG - Intergenic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104963512 12:132499029-132499051 CAGGGGACAGCAGAGGTGGCAGG - Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108667107 13:52643534-52643556 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109868605 13:68301497-68301519 CAGCCAAGCCCAGTGGTGGCAGG - Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110012950 13:70362277-70362299 CAGCCTGCAGAAGTGCAGGCAGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112914167 13:104525585-104525607 CAGAGTAGACCAGTGGTGGCAGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114847644 14:26343208-26343230 CTGCCTCTGGCAGTGGTGGCTGG - Intergenic
1116375720 14:44197793-44197815 CAGCCTTCAGAAGTGTTGGTTGG - Intergenic
1116686105 14:48040596-48040618 CAGATGCCAGCAGTGGTGGCTGG + Intergenic
1118049578 14:62012351-62012373 CAGCCTCCAGCAGTTGAGGGTGG - Intronic
1118166976 14:63346358-63346380 CAGCCTCCAGCATTGAGGGCTGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119627609 14:76193693-76193715 CACTCTACAGCAGTGGTGAGGGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120216386 14:81684955-81684977 CAGCCTAGAGAGGTGGAGGCAGG - Intergenic
1122249767 14:100429700-100429722 CAGCCAGCAGCATTGGTGTCAGG + Intronic
1123795168 15:23763662-23763684 CAGCCTGGAGCAGTGGTGGGAGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125600272 15:40911789-40911811 TAGCCTACAATGGTGGTGGCTGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126793631 15:52242806-52242828 CATCCTACTGCATTGGGGGCTGG - Intronic
1127258154 15:57308290-57308312 CAGGCTAAAGCAGTGGAGACGGG - Intergenic
1128392473 15:67191658-67191680 CAGCTTGCAGAAGTGCTGGCAGG - Exonic
1128582855 15:68820983-68821005 CAGCCAATGGCAGTGGCGGCGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132131474 15:99284513-99284535 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1132478318 16:153522-153544 GAGCCTGCAGAAGGGGTGGCGGG + Intronic
1132480403 16:164112-164134 GAGCCTGCAGAAGGGGTGGCGGG + Intronic
1132618178 16:852551-852573 GAGCCCACAGCAGTAGTGACTGG - Intergenic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137841721 16:51646859-51646881 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1138274255 16:55720345-55720367 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1138532341 16:57641261-57641283 ATGCCTAGAGCAGGGGTGGCAGG - Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141438116 16:84012507-84012529 CATCCTACAGCTGAGGAGGCGGG - Intronic
1141761183 16:86029654-86029676 CAGCCGGCAGCGGTGGGGGCGGG + Intergenic
1142260367 16:89039966-89039988 CACCCCAGAGCAGTGGGGGCGGG + Intergenic
1142582343 17:949827-949849 CAGCCTGGAGCAGTGGGGGCTGG + Intronic
1143579231 17:7815458-7815480 CACCCAACAGCAGTTGTGCCTGG - Intronic
1143664794 17:8351071-8351093 CATCCTGCAGCAGAGGTGACAGG + Intergenic
1143950467 17:10628731-10628753 CAGCCGGCAGAAGTGGTGGGTGG - Intronic
1147961578 17:44170837-44170859 CCGCCTGCAGCAGGAGTGGCTGG + Exonic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149932463 17:60769649-60769671 CAGCCTGCAGCAGTGGCAGTGGG + Intronic
1151500853 17:74487793-74487815 CATCTTACATCAATGGTGGCAGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156003429 18:32412113-32412135 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157599920 18:48887550-48887572 CAGCCTGCTGCGGTGGGGGCAGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1159188683 18:65013349-65013371 CAGCATACAGCAAAGGTGTCAGG + Intergenic
1159661954 18:71108042-71108064 CATCCTACAGTACTGGTGTCAGG - Intergenic
1159777386 18:72619308-72619330 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1159946301 18:74446962-74446984 CAGCCTGGGGCCGTGGTGGCCGG - Exonic
1161179854 19:2872668-2872690 CTGCCCACAGGTGTGGTGGCGGG + Intronic
1162457828 19:10796530-10796552 CAGCCTCCAGCAGTTGACGCGGG - Intronic
1162600662 19:11665968-11665990 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165910853 19:39226086-39226108 AAGCCTACAGCTGTGGGGCCAGG + Intergenic
1166747354 19:45147655-45147677 CAGGCTCCTGCAGTGCTGGCTGG - Intronic
1166856392 19:45784428-45784450 CAGCCTAGAGCAGTGGCCTCTGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168693958 19:58394798-58394820 CAGACAACAGCACAGGTGGCTGG - Exonic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926993727 2:18710267-18710289 CAGCCTACAGAAGCTGGGGCTGG - Intergenic
928674557 2:33637542-33637564 CAGCCAAATGCAGTGGTGGCAGG + Intergenic
929042421 2:37758421-37758443 CAGCCCACAGCAGAGGTTGCTGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929878201 2:45814460-45814482 CAGCCCCCAGCAGTGTTGCCAGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933920054 2:87036499-87036521 CAGCCTAAAGCAGAGCTGCCTGG + Intergenic
933928448 2:87123231-87123253 CAGCCTAAAGCAGAGCTGCCTGG + Intergenic
933931570 2:87157287-87157309 CAGCCTAAAGCAGAGCTGCCTGG - Intergenic
934002941 2:87733399-87733421 CAGCCTAAAGCAGAGCTGCCTGG - Intergenic
934943594 2:98520212-98520234 CACACTGCAGCAGTGCTGGCAGG + Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936060606 2:109293433-109293455 CAGGCTACCCCAGTGGTGACCGG + Intronic
936361550 2:111808147-111808169 CAGCCTAAAGCAGAGCTGCCTGG + Intronic
937465748 2:122131676-122131698 CAGCCCACAGCAGTGGCAGTGGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
942046112 2:172100427-172100449 CAGCCTGCAGGAGAGGTGGGTGG + Exonic
942882826 2:180883295-180883317 CAGCCTACATCAATGTTGGTGGG - Intergenic
943955869 2:194188397-194188419 CAGCCAAACACAGTGGTGGCAGG + Intergenic
944573100 2:201064130-201064152 CAGCCAAGCACAGTGGTGGCAGG + Intronic
944768829 2:202891879-202891901 CAGAGTACAACAGTGGTTGCCGG + Intronic
944831322 2:203535765-203535787 CAGCCTCCAGCAGTTCTGTCAGG + Intergenic
947984728 2:234438410-234438432 CAGCCTTCAGCAGAGGAGGCAGG - Intergenic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
948908785 2:240992734-240992756 CACTCTCCAGCAGTGGGGGCAGG - Intronic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173571962 20:44082889-44082911 CTGCCTAGAGCAGTGGGGGCAGG - Intergenic
1173779766 20:45745630-45745652 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1175778624 20:61668462-61668484 CAGCCTCCAGCAGGGGCAGCTGG - Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177276060 21:18914024-18914046 CATCATTCACCAGTGGTGGCAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1180141031 21:45893462-45893484 CAGCCTACAGCTGTGGCCACGGG - Intronic
1180969231 22:19806422-19806444 CAGCCAGCAGCAGTGGCAGCAGG - Intronic
1181099846 22:20531861-20531883 CAGCCGACAGCAGGGGTGCCTGG + Intronic
1184293612 22:43510641-43510663 CATCCTGCAGCAGAGGTGCCTGG + Intergenic
1184699360 22:46160022-46160044 CAGGCTGCTGCAGTGGTGGTCGG - Intronic
1185325117 22:50221729-50221751 AAGCCTCTAGCAGTGGGGGCTGG - Exonic
1203294610 22_KI270736v1_random:29912-29934 CAGCCCACAGCAGAGGTTGCTGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950536252 3:13580678-13580700 CACCCCACAGCAGTGTTGGTGGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954755860 3:52839363-52839385 AAGGCTGCAGCAGTGGGGGCTGG + Exonic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960685528 3:120289963-120289985 CAGCCCACGGCAGGGGTGGGCGG - Intergenic
960753556 3:120983024-120983046 CTGCCTTGAGCAGTGGAGGCAGG + Intronic
960977316 3:123187840-123187862 CAGCCTACTGCTGTGATGGTTGG + Intronic
961369668 3:126421804-126421826 CAGCATGCCCCAGTGGTGGCTGG - Intronic
963044360 3:141091838-141091860 CAACCTACAGAGGTGGTGACAGG + Intronic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963403382 3:144831782-144831804 CAGTTCACAGCAGAGGTGGCTGG + Intergenic
963587696 3:147214091-147214113 TAGTCCACAGCAATGGTGGCAGG + Intergenic
963664509 3:148166236-148166258 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
967119974 3:186374136-186374158 GAGGCTATAGCAGTGATGGCTGG - Intergenic
968653304 4:1768364-1768386 CACCCTACAGCAGGTGTGGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969313555 4:6368271-6368293 CAGCCAGCAGCAGGCGTGGCTGG + Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972232709 4:37093751-37093773 CAGCCTACTGCAAGGGTGACAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975177243 4:71301806-71301828 AAGTCAACAGCAGAGGTGGCTGG - Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976002262 4:80386984-80387006 CAACCCACCGCAGTGGGGGCAGG - Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977654549 4:99505690-99505712 CAGTCTCCAGCAGGGGTGGAGGG - Intergenic
978126150 4:105137509-105137531 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985120018 4:186631052-186631074 CAGCCTCCAGCAGAGGTAGGCGG - Intronic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
985475523 5:76811-76833 TAGCCTACACCAGAAGTGGCAGG + Intergenic
986290662 5:6396721-6396743 CAGCCTCCAGCAGCGGGAGCAGG + Intergenic
987058346 5:14217525-14217547 CAGGCTGCAGCTGTCGTGGCTGG - Intronic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988492908 5:31720036-31720058 CAGCATCCAGCATTGGTGCCAGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
991371977 5:65927754-65927776 CTGCCTACATCTGTGGGGGCAGG + Intronic
992286585 5:75241844-75241866 CAGCCTATAGGAGTTGTGGGTGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992808120 5:80358976-80358998 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993853739 5:93044589-93044611 CAGCCTCCAGCCTGGGTGGCAGG + Intergenic
995182239 5:109239809-109239831 CAGCTTTCAGGAATGGTGGCTGG + Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
997759350 5:136429940-136429962 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
998292259 5:140926763-140926785 CAGCCCGCAGCAGTGACGGCCGG + Intronic
998502460 5:142645369-142645391 CAGCCTACAGCAGGCGTGGTGGG + Intronic
999287592 5:150403386-150403408 AAGCCCACAGCAGTGGTGTGTGG - Intronic
1002078352 5:176723188-176723210 CAGCTTCCCGCAGTGGGGGCTGG + Intergenic
1003283291 6:4712499-4712521 CAGCCCACAGCAGCCATGGCTGG + Intronic
1003379335 6:5609126-5609148 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004280449 6:14275687-14275709 GAGCCTCCAGCAGAGGTGGGTGG + Intergenic
1004662665 6:17723865-17723887 CAGCAGCCAGAAGTGGTGGCGGG + Intergenic
1005255896 6:24002508-24002530 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006204265 6:32326257-32326279 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1006830217 6:36963911-36963933 CAGCCAACACCAGAGGAGGCAGG - Exonic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013151212 6:107448076-107448098 CTGCATACAGCAGGGGGGGCTGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017772612 6:157654642-157654664 CAGCCCCCAGCAGAGATGGCTGG + Intronic
1018109259 6:160519861-160519883 CAACCTACAGAAGTTCTGGCTGG + Intergenic
1018181629 6:161228251-161228273 CAGCCTGTAGCAGGGGAGGCAGG + Intronic
1019384497 7:746836-746858 CAGCCCACAGCAGCAGTGCCAGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021122904 7:16816876-16816898 CAGCCTGCAGCACTGTTGGGTGG + Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026103518 7:67402314-67402336 CAGCCTTCACCAATGATGGCAGG + Intergenic
1026440244 7:70437884-70437906 CAGTCTTCAGCAGTGGTAGAAGG + Intronic
1027964210 7:84984588-84984610 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029704719 7:102270224-102270246 CAGCCTCCAGCAGAGAAGGCAGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1033220361 7:139523550-139523572 CAGCCTCCAGCCCAGGTGGCGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035289452 7:157828250-157828272 CAGCCTACAGCAGGGGCATCCGG - Intronic
1035658017 8:1325647-1325669 CAGCCTCCAGCAGTGATTGGCGG + Intergenic
1035672667 8:1432076-1432098 CAGCCTGTAGCAGTGCTGGCTGG - Intergenic
1036908038 8:12724320-12724342 CAGTCTACAGCAGTGGAGAAAGG - Intronic
1037800653 8:22033406-22033428 CAGCCTACAGAGGTCATGGCAGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041808782 8:61885026-61885048 CAGCCTAGAGAAGTGGTGGCTGG + Intergenic
1043589284 8:81808812-81808834 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1043628236 8:82291523-82291545 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046424572 8:114030113-114030135 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047753627 8:127901169-127901191 AAGCCCACAGCAATGGTGCCTGG - Intergenic
1047791230 8:128205793-128205815 CTGCCTACAGGAGGTGTGGCCGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049015728 8:139918662-139918684 CTTCCCACAGCAGTGCTGGCTGG - Intronic
1050373229 9:4944569-4944591 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1050599707 9:7238118-7238140 CAGCATCCATCAATGGTGGCAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052323833 9:27196014-27196036 AATCATACAGCTGTGGTGGCAGG - Intronic
1053070757 9:35100555-35100577 CAGCATAGAGCACTGGTGCCAGG - Intronic
1056117462 9:83454744-83454766 CAAGCTACTGAAGTGGTGGCTGG - Intronic
1056177108 9:84045692-84045714 CAGCCTGTAGCAGTGGTTGCAGG + Intergenic
1056645759 9:88410428-88410450 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1056685229 9:88753636-88753658 GAGCCCAGAGGAGTGGTGGCTGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1059674792 9:116527883-116527905 AAGCTTACAGTAGTGGTGGAAGG - Intronic
1060721611 9:125983350-125983372 CAGATTACTGCAGTGGAGGCTGG - Intergenic
1062087924 9:134658191-134658213 CACCCTACAACCGTGGTGGTGGG + Intronic
1062417400 9:136459096-136459118 CAGCCTGCAGCTGTCATGGCTGG - Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195023753 X:100855187-100855209 CAGCCAAACACAGTGGTGGCAGG - Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195831195 X:109060901-109060923 CAGCATCCAGCAGTGGTGCCTGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196625119 X:117869543-117869565 CAGAATACAGCAGAGGTTGCTGG + Intergenic
1196763475 X:119221823-119221845 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1197846741 X:130811127-130811149 CTGCCTACATGAGTGGTCGCAGG + Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200167519 X:154047463-154047485 CAGCTTAGCGCAGTGGTGGTGGG + Intronic
1200228289 X:154431458-154431480 CAGCCAAGAGCATTTGTGGCAGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic