ID: 948726931

View in Genome Browser
Species Human (GRCh38)
Location 2:239939857-239939879
Sequence ACTGCAGCCGGTTCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948726931_948726942 25 Left 948726931 2:239939857-239939879 CCCCTCCTGGAACCGGCTGCAGT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 948726942 2:239939905-239939927 GCAGCCAGCCCTACTCAGTCAGG 0: 1
1: 0
2: 3
3: 11
4: 119
948726931_948726937 1 Left 948726931 2:239939857-239939879 CCCCTCCTGGAACCGGCTGCAGT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 948726937 2:239939881-239939903 CAGGCCAAGCTGCGATTCCATGG 0: 1
1: 0
2: 3
3: 14
4: 122
948726931_948726938 2 Left 948726931 2:239939857-239939879 CCCCTCCTGGAACCGGCTGCAGT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 948726938 2:239939882-239939904 AGGCCAAGCTGCGATTCCATGGG 0: 1
1: 0
2: 0
3: 7
4: 52
948726931_948726943 26 Left 948726931 2:239939857-239939879 CCCCTCCTGGAACCGGCTGCAGT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 948726943 2:239939906-239939928 CAGCCAGCCCTACTCAGTCAGGG 0: 1
1: 0
2: 0
3: 20
4: 181
948726931_948726939 3 Left 948726931 2:239939857-239939879 CCCCTCCTGGAACCGGCTGCAGT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 948726939 2:239939883-239939905 GGCCAAGCTGCGATTCCATGGGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948726931 Original CRISPR ACTGCAGCCGGTTCCAGGAG GGG (reversed) Intronic
900596913 1:3484099-3484121 ACTGCCGCCGGCTCCAGGGCTGG + Intergenic
900736647 1:4303404-4303426 ACTGCAGCCAGTTCCTGGCCGGG + Intergenic
900757624 1:4447863-4447885 ACCGCAGCAGGTTCTAGGACAGG - Intergenic
901403646 1:9031802-9031824 ACTGGAGTGGGTGCCAGGAGTGG + Intergenic
904940859 1:34164373-34164395 TCTGCAGTCGGTTCCAGAGGGGG + Intronic
906696915 1:47829275-47829297 TCTCCAGCCAGTTCCTGGAGGGG + Intronic
907603568 1:55794009-55794031 ACTGCAGCTGCACCCAGGAGGGG - Intergenic
919910277 1:202106798-202106820 AGCTCAGCCAGTTCCAGGAGGGG + Intergenic
920077382 1:203347352-203347374 TCTGCAGCTGGTTGTAGGAGAGG + Exonic
1062895093 10:1097311-1097333 ACCGCAGCAGGATCCAGGACTGG + Intronic
1063361969 10:5466672-5466694 CCTGCAGCAGTTTCCAGGCGTGG - Intergenic
1065047142 10:21754613-21754635 AAGGAAGCCGGTTCCTGGAGAGG - Intergenic
1065542696 10:26785826-26785848 ACTGCACTCTGTTACAGGAGAGG - Intronic
1067278092 10:44851990-44852012 AATGCAGCCGGGCCCAGGATGGG + Intergenic
1067534873 10:47101650-47101672 ACAGCAGCAGGTTGCAGGAAAGG + Intergenic
1069858391 10:71454563-71454585 ACTGCTGCCCGTGCCATGAGTGG - Intronic
1073577927 10:104640931-104640953 AATCAAGCCGGATCCAGGAGGGG - Intergenic
1076307354 10:129474587-129474609 ACTGCAGCCGCGTTCAGGCGAGG + Intronic
1076618935 10:131774807-131774829 ACTGCAGCGGGTTCTCGGTGGGG - Intergenic
1077250134 11:1557240-1557262 CCTGCAGGCGGTCCGAGGAGAGG + Exonic
1079008634 11:16810515-16810537 AGTTCAGCTGGTTCCTGGAGAGG + Intronic
1081663907 11:44905351-44905373 ACTGCAGGTGCTTCCAGCAGGGG - Intronic
1081984073 11:47289000-47289022 ACTGAAGCCGGCCCCGGGAGTGG + Exonic
1085732499 11:79011592-79011614 CCAGCAGCCAGTTCCTGGAGAGG - Intronic
1089626283 11:119753097-119753119 ACGGCTGCCACTTCCAGGAGGGG - Intergenic
1092035695 12:5332778-5332800 ACTGCAGAGGGCTCCACGAGTGG + Intergenic
1092905939 12:13101015-13101037 AATGCAGTCATTTCCAGGAGAGG + Intronic
1096157676 12:49349630-49349652 ACAGCAGCTGCTTTCAGGAGTGG + Exonic
1099667729 12:85653467-85653489 ACTGCAGCTTGTTGGAGGAGTGG + Intergenic
1101441056 12:104704487-104704509 ACTGCTGCTGGTTAGAGGAGGGG + Intronic
1102628378 12:114254837-114254859 TCTGAAGCACGTTCCAGGAGAGG - Intergenic
1103882166 12:124174638-124174660 ACTTCAGCCAGTTCCAGAGGAGG + Intronic
1104708652 12:130968878-130968900 CCTGCAGCAGGCACCAGGAGGGG - Intronic
1107319417 13:39169638-39169660 ACTGCTTCCGTTTCCAGGACTGG - Intergenic
1112388812 13:98964182-98964204 ACAGCAGCAGGGACCAGGAGTGG + Intronic
1112390507 13:98979462-98979484 GCTGCAGCAGGTGCTAGGAGAGG - Intronic
1121030666 14:90656011-90656033 GGTGCAGGCGGTTCCAGGAGTGG - Intronic
1121245227 14:92457232-92457254 GCTGCAGCAGGGGCCAGGAGAGG - Intronic
1122150997 14:99726226-99726248 ACTGCTGCCCGATGCAGGAGCGG - Exonic
1128297092 15:66531743-66531765 ACTGCACCCAGTTCCAGAAATGG + Intronic
1128594340 15:68930440-68930462 CCTGCACGCGGTCCCAGGAGGGG + Intronic
1130403186 15:83575945-83575967 AAGGCAGCCTGTTCCATGAGTGG + Intronic
1131295109 15:91141091-91141113 AATGTAGCCAGTTCCAGAAGTGG - Intronic
1132202314 15:99963438-99963460 AAGGCAGCTGGTGCCAGGAGTGG + Intergenic
1133522270 16:6570349-6570371 ACTTTGGCCTGTTCCAGGAGGGG - Intronic
1136055843 16:27688972-27688994 ACTACAGCCAGGGCCAGGAGTGG + Intronic
1136994761 16:35182012-35182034 AGGGCAGCAGGTCCCAGGAGAGG - Intergenic
1139474577 16:67196594-67196616 GCTGCAGCCCTCTCCAGGAGTGG - Intronic
1142226889 16:88881877-88881899 CCTGCAGCACGTCCCAGGAGGGG - Intronic
1143709968 17:8727381-8727403 ACTGAAGGAGGTTCCAGGGGAGG - Intergenic
1146582284 17:34049421-34049443 AATGCAGCCTGTTCCTGGAACGG - Intronic
1147184719 17:38706839-38706861 ACTAGAGCCAGTTCCAGCAGTGG - Intronic
1147609566 17:41793595-41793617 ACTGCGGCTGGAGCCAGGAGAGG + Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1152633503 17:81421093-81421115 ACTGCAGGCAGTGCCAGGATGGG + Intronic
1152651272 17:81494453-81494475 ACTGCAGGCGGTTCAATGTGTGG + Intergenic
1154255464 18:12777661-12777683 AGGGAAGCCGGTTCCAGGAAGGG - Intergenic
1155215682 18:23641383-23641405 ACTGGAGCAGGTGCCGGGAGTGG - Intronic
1158082785 18:53614197-53614219 ACTGCAGCCGGGGCCAGGCGCGG + Intergenic
1159005334 18:63005483-63005505 ACTGCAGCCGCCAGCAGGAGTGG + Intergenic
1160232240 18:77057215-77057237 ACCGCAGCTGGTTCCTTGAGGGG - Intronic
1160496869 18:79380990-79381012 ATTTCAGGCGGTTCCAGAAGGGG + Intergenic
1164984367 19:32637787-32637809 ATTGAAGTCGGTGCCAGGAGTGG - Intronic
1166097646 19:40551069-40551091 CCAGCAGCAGGTTCCAGGGGAGG - Intronic
927092709 2:19724274-19724296 ACTGCAGCCAGATCCAGAGGCGG + Intergenic
927141763 2:20135787-20135809 GCTGCGGCCGGTTCCAGCAGGGG + Intergenic
927695749 2:25238728-25238750 GCCACAGCCTGTTCCAGGAGAGG - Intronic
931360531 2:61574213-61574235 ACTGCAGCTGGGGCCAGGTGCGG + Intergenic
934747223 2:96767357-96767379 ACTGCAAACAGTTCCAGGCGAGG - Intronic
937335600 2:121060407-121060429 ACTGCAGCCCTTTCCAGATGGGG + Intergenic
938307470 2:130265413-130265435 ACTGCAGCCTGGGCCAAGAGTGG - Intergenic
938447862 2:131391429-131391451 ACTGCAGCCTGGGCCAAGAGTGG + Intergenic
939656125 2:144827682-144827704 ACTGCAGCACATTTCAGGAGAGG + Intergenic
941629344 2:167866688-167866710 ACAGGAGCCTCTTCCAGGAGAGG + Intergenic
947740234 2:232481595-232481617 AGTGCAGCAGGTTCCCTGAGCGG + Exonic
948726931 2:239939857-239939879 ACTGCAGCCGGTTCCAGGAGGGG - Intronic
948777300 2:240296400-240296422 AGAGCACCCGGTCCCAGGAGGGG - Intergenic
1169046576 20:2538152-2538174 ACAGCAGCGGGTCACAGGAGCGG - Intronic
1169513723 20:6294202-6294224 ACTGCATACCGTTCCAGCAGTGG - Intergenic
1171216235 20:23354433-23354455 ACTGCTTCCGCTTCCAGGACTGG + Exonic
1175338622 20:58213317-58213339 ACTGCAGATGCTTCCAGCAGAGG - Intergenic
1179886869 21:44317979-44318001 ACTGTGGCCGGTTCCCGGGGTGG + Intronic
1179906334 21:44425057-44425079 GCTGCAGCCTGTTCCAGGCAGGG + Intronic
1181351320 22:22260499-22260521 ACTGGGGCCTGTTGCAGGAGGGG + Intergenic
1182486514 22:30642335-30642357 ACTGCAGGAGGCTCCAGGAGAGG + Intronic
1182499106 22:30732687-30732709 ACAGCAGACAGGTCCAGGAGTGG - Intronic
1183085593 22:35485057-35485079 CCAGCAGCCAGTTCCAGGATGGG - Intergenic
1183094098 22:35541885-35541907 GCTGCAGCCAGCTCCAGAAGAGG - Intronic
1183415830 22:37681328-37681350 CCTGCAGCTGGTTCCCAGAGAGG - Intergenic
1185113997 22:48920813-48920835 TCTGAAGCCAGTGCCAGGAGGGG + Intergenic
1185207989 22:49551161-49551183 ACTGCAGCCTCTGCCAGCAGGGG - Intronic
954115553 3:48465184-48465206 ACTGCAGCCTGTTCCAGCACTGG + Intronic
958719084 3:97822438-97822460 ACTGCAGCCTGGCCCAAGAGCGG - Intronic
959869815 3:111313529-111313551 TCCCCAGTCGGTTCCAGGAGAGG + Intronic
959995321 3:112674400-112674422 ACTGCATCTGGTTTAAGGAGAGG + Intergenic
962087395 3:132206048-132206070 ACAGCAGCTGGGTCCAGGACTGG + Intronic
963250110 3:143095430-143095452 ACTGGAGCAGGTGCCAGGAGCGG - Intergenic
964590803 3:158360717-158360739 ATTGGAGCAGGTGCCAGGAGTGG + Intronic
967820636 3:193835875-193835897 ACTCCAGACGGTGCCTGGAGAGG - Intergenic
968085138 3:195870790-195870812 ACTGCAGACACCTCCAGGAGAGG - Intronic
968405464 4:336641-336663 ACGGCAGCCGGGTCCGGGTGGGG + Intergenic
970445939 4:16123407-16123429 AGTGCAGCCTGTGCCAGGTGTGG - Intergenic
971867271 4:32189417-32189439 ACTACAGCAGGCACCAGGAGTGG - Intergenic
975628753 4:76378185-76378207 ACTCCAGCCGGCCACAGGAGGGG - Intronic
975728021 4:77311180-77311202 ACTGCAGTCAGTTGCAGTAGAGG + Intronic
978248646 4:106604639-106604661 ACTGGAGTGGGTTCCATGAGTGG + Intergenic
979347374 4:119604515-119604537 ACTGTAGCAGATTCCAAGAGGGG - Intronic
984457963 4:179995224-179995246 ATTGCAGCCAGCTCCAGGAAGGG + Intergenic
984531377 4:180920619-180920641 ACTGCAAACCGTTCCAGGAATGG - Intergenic
986517525 5:8579873-8579895 ACTGAAGACGGATCCAGGAGTGG - Intergenic
986597303 5:9437077-9437099 ACTGCAGAAGGTCCCAGGACAGG + Intronic
987129916 5:14850667-14850689 ACAGCAGCCAGCTCCAGGAGAGG - Intronic
988554461 5:32224097-32224119 ACTGCAGTAGCCTCCAGGAGAGG - Intergenic
992410625 5:76501931-76501953 AATGCAGCAGGGGCCAGGAGCGG - Intronic
998023288 5:138789743-138789765 ACCGCACCCGGCTGCAGGAGAGG + Intronic
999439951 5:151593350-151593372 TCTGCAGCCTATTGCAGGAGGGG + Intergenic
1002608814 5:180400317-180400339 AATGCAGATGGTTCCAGGTGTGG - Intergenic
1002934702 6:1661760-1661782 ACTGCAGCTGGACCCAGCAGTGG - Intronic
1004036771 6:11931913-11931935 ACAGGAGCCGGTGCAAGGAGAGG + Intergenic
1004494413 6:16150266-16150288 ACTGCTGCAGGGTCAAGGAGGGG + Intergenic
1009530290 6:64803823-64803845 ATTGGAGCAGGTGCCAGGAGTGG + Intronic
1009741501 6:67752716-67752738 ACAGCAGCCGGGGCCAGGCGCGG - Intergenic
1016996272 6:149964190-149964212 ACTGCAGCGGGTTTCAGAGGAGG + Intronic
1017005419 6:150025309-150025331 ACTGCAGCGGGTTTCAGAGGAGG - Intronic
1017011884 6:150068901-150068923 ACTGCAGCGGGTTTCAGAGGAGG - Intronic
1018230589 6:161671373-161671395 AATGCAGCCGGTTGCAGTGGGGG - Intronic
1019464442 7:1179609-1179631 ACAGCAGTCAGTGCCAGGAGCGG - Intergenic
1024101499 7:46037095-46037117 ATTGCAGCCTGTCCCAGGAGTGG - Intergenic
1027045897 7:74991331-74991353 ACTGAAGCCGGGACAAGGAGTGG + Intronic
1028718734 7:94004480-94004502 TGTGAACCCGGTTCCAGGAGCGG + Intergenic
1034395934 7:150824915-150824937 TCTGCAGCCTGACCCAGGAGAGG - Intronic
1035196229 7:157222924-157222946 AATGCAGCCAGATCCAGCAGTGG - Intronic
1041965535 8:63670488-63670510 ATTGGAGCAGGTGCCAGGAGTGG + Intergenic
1042189796 8:66174489-66174511 GCTGCAGCCTGTCCCTGGAGGGG - Exonic
1047022750 8:120793559-120793581 ACTGGAGCTGGTTCCTTGAGTGG - Intronic
1048860685 8:138722662-138722684 ACTGCAGCTGTTTGCAGGTGAGG + Intronic
1049621249 8:143599289-143599311 CCTGCACCAGGTCCCAGGAGAGG - Exonic
1051170243 9:14314052-14314074 ACTGCGGCAGGATCCCGGAGTGG + Intronic
1059199196 9:112398647-112398669 ACTGCAGGGGGTTACAGGATTGG + Intronic
1060147450 9:121265210-121265232 TCTGAAGCCAGCTCCAGGAGAGG + Intronic
1060343539 9:122797406-122797428 ACAGCAGCAGGGCCCAGGAGTGG - Intergenic
1061088278 9:128411947-128411969 ACTGCACCCAGAACCAGGAGTGG + Intronic
1062127019 9:134869434-134869456 AGGGCAGCTGGTCCCAGGAGAGG - Intergenic
1190072720 X:47292386-47292408 ACTCCAGCCACTTCCCGGAGAGG + Intergenic
1194985557 X:100486032-100486054 GCTGCAGCAGCTGCCAGGAGTGG - Intergenic