ID: 948735209

View in Genome Browser
Species Human (GRCh38)
Location 2:239999226-239999248
Sequence CGTGCATCCCTACGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948735209_948735213 3 Left 948735209 2:239999226-239999248 CCTGTTTCACGTAGGGATGCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 948735213 2:239999252-239999274 TCATTCTGGACAGGGAACAACGG 0: 1
1: 0
2: 2
3: 14
4: 221
948735209_948735211 -6 Left 948735209 2:239999226-239999248 CCTGTTTCACGTAGGGATGCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 948735211 2:239999243-239999265 TGCACGTTTTCATTCTGGACAGG 0: 1
1: 0
2: 1
3: 3
4: 138
948735209_948735212 -5 Left 948735209 2:239999226-239999248 CCTGTTTCACGTAGGGATGCACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 948735212 2:239999244-239999266 GCACGTTTTCATTCTGGACAGGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948735209 Original CRISPR CGTGCATCCCTACGTGAAAC AGG (reversed) Intronic
900098343 1:949550-949572 CCTGCATCCCTGCGTGAGAGGGG + Intronic
915369656 1:155337877-155337899 CCTCCAACCCTACGTGAAAAAGG + Intronic
915488119 1:156236110-156236132 TGTGCATTCCTACGAGGAACAGG + Intronic
917908866 1:179619034-179619056 CATGGATCTCTACATGAAACAGG - Intronic
920121839 1:203664703-203664725 GGTGCATCCCCATGTCAAACTGG + Intronic
1065638859 10:27759967-27759989 CCTGCAGCCCTAAGTGACACAGG + Intergenic
1073516699 10:104082336-104082358 CATGCAAACCTACGTGCAACTGG + Intronic
1084019908 11:66411179-66411201 GGCTCATCCCTACCTGAAACTGG + Intergenic
1091335711 11:134764353-134764375 CCTGCAGAACTACGTGAAACAGG - Intergenic
1104530527 12:129565900-129565922 AGGACATCCCTAAGTGAAACTGG - Intronic
1135184992 16:20307675-20307697 CATACATCCCTACGAGACACAGG - Intergenic
933478129 2:82818719-82818741 CTTTCATGCCTTCGTGAAACAGG + Intergenic
942135158 2:172918174-172918196 CGTGCATCCCTTCTTTAAAAGGG - Intronic
948735209 2:239999226-239999248 CGTGCATCCCTACGTGAAACAGG - Intronic
1174576755 20:51542604-51542626 CGTGCGTCCCTACGAGGAAAGGG - Exonic
1175787094 20:61718523-61718545 CGTGCTTCCCTTCCTGGAACAGG + Exonic
980656528 4:135794177-135794199 CCTGCATCCCTACATGAAAATGG - Intergenic
1000567500 5:162867844-162867866 CATACATACATACGTGAAACTGG - Intergenic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1014791796 6:125681009-125681031 CATGCACCTCTACATGAAACAGG + Intergenic
1024550149 7:50555992-50556014 CTTGCAGCCCTAGGAGAAACTGG - Intronic
1025741522 7:64201424-64201446 GGTGGATCCCTAGGAGAAACAGG + Intronic
1030232866 7:107226103-107226125 AGTGCATCACTAGGTAAAACAGG - Intronic
1039088876 8:33806884-33806906 AGTGCCTTCCTATGTGAAACAGG - Intergenic
1051096203 9:13468336-13468358 GCTGTATCCCTACGTGGAACAGG + Intergenic
1055552026 9:77440277-77440299 CACGGATCCCTGCGTGAAACCGG - Intronic