ID: 948738752

View in Genome Browser
Species Human (GRCh38)
Location 2:240028893-240028915
Sequence CTGCTGGGACAGGTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 456}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948738742_948738752 28 Left 948738742 2:240028842-240028864 CCTTATCTGTGTTTAGATGCATA 0: 1
1: 0
2: 15
3: 141
4: 799
Right 948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 36
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948738752 Original CRISPR CTGCTGGGACAGGTGGGACA GGG Intergenic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900515739 1:3081442-3081464 CAGCTCGGTCTGGTGGGACAAGG - Intronic
900621742 1:3590719-3590741 CTGCTGGCAGGGGAGGGACAGGG - Intronic
900744475 1:4351732-4351754 CTGCTGGGTCAGGTGGGGTCAGG + Intergenic
900780149 1:4612613-4612635 CTGGTGGGGCAGGAGGCACAGGG - Intergenic
901301042 1:8200345-8200367 CAGCTGGGACAGGTTGGAAAGGG + Intergenic
901428205 1:9196969-9196991 TCCCTGGGACATGTGGGACACGG - Intergenic
902979488 1:20112897-20112919 TTGGTGGGAGAGGTGGGGCAGGG + Exonic
904647394 1:31978069-31978091 CTGCAGGGGCAGATGGGAGATGG + Intergenic
905005755 1:34709068-34709090 TTTCTGGGACAGGTGGCAGAAGG - Intergenic
905146801 1:35893477-35893499 CTGCAGGGACAGATGGGATGAGG - Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
905890487 1:41515875-41515897 CTGCTGAGACTGGGGGGACAGGG - Intronic
906527896 1:46507066-46507088 CTGCTGGTGCAGGTTGTACATGG - Exonic
906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG + Intronic
906838060 1:49105399-49105421 CAGCTGTAACAGGTGGGGCATGG - Intronic
907455303 1:54571862-54571884 CTGCTGGGGGAGCTGGGAGAAGG + Intronic
909449831 1:75785724-75785746 CTGATGGGTCAGGTTGGAGATGG - Intronic
909978510 1:82071407-82071429 TTGCTGGGACAGGTTGGGGAGGG + Intergenic
910346719 1:86247417-86247439 CTCCTGCGGCAGGTGTGACATGG + Intergenic
912719833 1:112010873-112010895 CTGCTGGGAGATGAGGGATAAGG + Intergenic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
913522667 1:119660574-119660596 ATGCAGGGCCAGGTGGGAGACGG + Intronic
915298964 1:154941329-154941351 GACCTGGGAGAGGTGGGACAGGG + Intergenic
915914033 1:159930621-159930643 CTGCTGGGAGAGCTGGGATATGG - Intronic
915939503 1:160109767-160109789 CCGCTGTGAGAGGTGGGACAGGG - Intergenic
916066460 1:161140041-161140063 CTGGTGGGATTGGTGAGACAGGG - Intergenic
916718227 1:167462626-167462648 CTGCTGGGAGAGGTGTGCCAGGG + Intronic
917369926 1:174281506-174281528 CTTCTGGGTCGGGTGGGACTTGG - Intronic
919801087 1:201355029-201355051 TTTCTGGGAAAGGTGGGGCAGGG - Intergenic
920112958 1:203599886-203599908 CTGGTTGGACTGATGGGACATGG - Intergenic
920200572 1:204257527-204257549 CTGCAGGGACAGGCGGCGCAGGG + Exonic
920226581 1:204443447-204443469 CTGCTGGGCCAGTTTGGCCAGGG + Exonic
920364378 1:205440365-205440387 CTCCTGGGCCAGGTGGGGCCAGG - Intronic
920683480 1:208090941-208090963 CTGCAGGGAGAGGTGGGAGTGGG - Intronic
922887139 1:229028713-229028735 CTGCTGGGGGAGGTGGGAGGTGG - Intergenic
923021611 1:230168438-230168460 CTCCGGGGACAGGAGGGGCAAGG - Intronic
923451548 1:234122616-234122638 CTGTTGGGCCATGGGGGACAAGG - Intronic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1064793026 10:18980231-18980253 CTGCTGGGCCTGTTGGGAAAGGG + Intergenic
1066181923 10:32970932-32970954 CTGCTTGGAAGGGTGGGAAAAGG - Intronic
1066984464 10:42453102-42453124 CTGCTGGGAGAGGCGGGGGATGG - Intergenic
1067844605 10:49709847-49709869 CTGCTGGGAGAGAAGGGAGAAGG - Exonic
1068746143 10:60532856-60532878 CTGCTGGGAAATGTTGGGCAGGG + Intronic
1069548975 10:69349311-69349333 CTGGTGAGGCAGGTGGGGCAGGG - Intronic
1069582883 10:69577375-69577397 CTTCTGGGACAGGTGTGTCCAGG - Intergenic
1069800086 10:71076561-71076583 CTGCAGTGACAGCTGAGACAGGG - Intergenic
1069854407 10:71431847-71431869 CTGCAGGGAGAGATGGGAGATGG + Intronic
1069997426 10:72351316-72351338 CTGCTGCAGGAGGTGGGACAAGG - Intronic
1070167711 10:73911164-73911186 CTGCGGGGACAGGTGGACCCTGG - Exonic
1070644234 10:78190411-78190433 ATGGTGAGACAGGTGGGACCAGG - Intergenic
1070736297 10:78865986-78866008 CTGCTGGAACAAGTGGGGCCTGG - Intergenic
1071140858 10:82507661-82507683 CTACTGGGACAGGCTGGAGAAGG + Intronic
1071525008 10:86353526-86353548 CTGCTGGAACGGGAGGAACATGG - Intronic
1071879768 10:89883906-89883928 CTGCTGGGATAGGCTTGACATGG - Intergenic
1072549772 10:96468736-96468758 GTGCAGGGCCAGGTGGGGCAAGG - Intronic
1072627957 10:97126278-97126300 CACATGGGACACGTGGGACATGG + Intronic
1072806924 10:98429693-98429715 CTCCTGGGAGAGCAGGGACAGGG - Intronic
1073604475 10:104880073-104880095 CTGGTTGGACAGGTGGTACATGG - Intronic
1074286279 10:112100895-112100917 CAGCTGGAGCAGCTGGGACATGG + Intergenic
1075066073 10:119289685-119289707 CTGCTGGGCCAGGAGAGACTCGG - Intronic
1075159565 10:120011491-120011513 CAGGTGGCACAGGAGGGACAAGG + Intergenic
1075630185 10:123995863-123995885 CTGCAGGGGGATGTGGGACAGGG + Intergenic
1075949373 10:126463591-126463613 TGGCTGGGACAGGAGGAACATGG - Intronic
1075975736 10:126692453-126692475 CTGATTGGTCAGGTGGGAGATGG + Intergenic
1076368090 10:129935221-129935243 CTGCTGTGACAGGTGCGAGTGGG - Intronic
1076816962 10:132919811-132919833 CAGCAGTGACAGGCGGGACAGGG + Intronic
1077614686 11:3666420-3666442 CTGCTGGGACACCTGGCACGGGG - Exonic
1078578192 11:12518621-12518643 TTGCTGGGGAAGGTGGGACTCGG + Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1081617855 11:44601164-44601186 CTGCTGGGAGAAGTGAGCCAAGG - Intronic
1081662981 11:44899790-44899812 CTGTAGGGTCAGGTGGGACCCGG - Intronic
1081713090 11:45230518-45230540 GGGCTGGGCCAGGTGGGACCTGG - Intronic
1081871476 11:46384539-46384561 CTGCTGGGGCGGGGGGGACCTGG + Intergenic
1082026631 11:47577469-47577491 CAGCTGGGCCAGGTGGGTCTTGG + Exonic
1083160217 11:60849920-60849942 CTCCTGGAACATGTGGGAGAAGG - Exonic
1083681600 11:64354159-64354181 CAGATGGGACAGGTGGGTCTGGG + Exonic
1083735410 11:64677517-64677539 GGGCAGGGACAGGTGGGGCAAGG - Intronic
1084270280 11:68025845-68025867 GTGATGGTACAGGTGGGGCAGGG - Intronic
1084422295 11:69066432-69066454 CTGCTGGGGGAGGGGGCACAGGG - Intronic
1084859195 11:72007160-72007182 CTGCTGGGACAGGGGCTGCAGGG - Intronic
1084964711 11:72738600-72738622 GTGCTGGGACAGCTGGGCCCAGG - Intronic
1088852781 11:113718933-113718955 CAGATGGGCCTGGTGGGACAGGG - Intergenic
1089446606 11:118557815-118557837 TTGCAGGGGCAGGTGGAACAGGG + Exonic
1089477036 11:118772847-118772869 CTGTTGGGACAGGGGAGACCAGG - Intronic
1089493574 11:118897875-118897897 CTGCAGGGAGGGGTGGGAGAGGG + Exonic
1089635426 11:119808662-119808684 CTGCTGGGACAGGGAGGCCTGGG + Intergenic
1089659857 11:119978737-119978759 CTGCTGGGGCAAGAGGGACCTGG - Intergenic
1089729856 11:120512745-120512767 CAGCTGGGACAGGGGGTTCAAGG + Intronic
1090830021 11:130414744-130414766 CTGCTGGTCCAGCTGGTACAGGG + Exonic
1092143636 12:6200424-6200446 CAGCTGGGACTGGCGGGACCTGG - Exonic
1092157687 12:6295106-6295128 CTCCTTGGAAGGGTGGGACAAGG - Intergenic
1092231804 12:6779934-6779956 CTGCTGGAGCAGGAGGGGCATGG + Intergenic
1092892081 12:12978562-12978584 CTGCTGGCAGTGGAGGGACAGGG + Intronic
1095396703 12:41770253-41770275 CTTCTGGGAGATGTGGCACATGG - Intergenic
1096192908 12:49631797-49631819 GGGCTGGAACAGGAGGGACAGGG - Intronic
1096503423 12:52079266-52079288 CTGCTGAGCCAGGAGGCACACGG - Intergenic
1097398521 12:59103641-59103663 TTGCTGGGGCAGGTGGGGGAGGG - Intergenic
1097680398 12:62643528-62643550 TTACTGTGACAGGTGGGATAAGG - Intergenic
1100309546 12:93381516-93381538 CTGTAGGGAAAGGTTGGACAAGG + Intronic
1101510883 12:105391239-105391261 GTGGTGGGACAGGGGAGACAGGG + Intronic
1102474482 12:113179834-113179856 GAGATGTGACAGGTGGGACAAGG + Intronic
1102691957 12:114768416-114768438 CTGCTGGGGCAGGGGGGAGAGGG - Intergenic
1103341016 12:120221239-120221261 CTGCTGGGCCATGTGGGACTTGG - Intronic
1103522963 12:121548702-121548724 CAGCTGGGACAGGAGGGACGGGG - Intronic
1103757220 12:123218094-123218116 GTGGTGGTACAGGTGGTACATGG - Intronic
1104155355 12:126126110-126126132 CTGCTGGACCAGGCGGCACAGGG + Intergenic
1106359692 13:29019215-29019237 CTGCAGGGACTGGTGGGAAGAGG + Intronic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1107684556 13:42884004-42884026 CTGCTGGGACAGAGGCTACAGGG - Intergenic
1107885627 13:44872281-44872303 CTGCTGGGACACGAGGGGCTGGG + Intergenic
1108109401 13:47051890-47051912 CTGCTTTGACAGGTGGTAGAAGG - Intergenic
1110278162 13:73662070-73662092 CTGTGGGGACAGGCGTGACATGG - Intergenic
1112452496 13:99525016-99525038 CTGATGGGTCAGGTGAGATAAGG + Intronic
1112693384 13:101919644-101919666 CTGCTGGGAGAGGTAGGGCTGGG - Intronic
1113768133 13:112893757-112893779 AAGCTGGGGCACGTGGGACAGGG - Intergenic
1113936446 13:113997517-113997539 GTCCTGGGGCAGGTGGGACAGGG + Intronic
1114332559 14:21652128-21652150 CTGCTGGGCCAGCTGGGAGAGGG + Intergenic
1114485932 14:23061623-23061645 CTGTGGGGAGAGGAGGGACAAGG + Intronic
1114687093 14:24543585-24543607 CTGGTGAGCCAGGTGGAACAGGG + Intergenic
1116056475 14:39870591-39870613 ATGCTGAGAGAAGTGGGACAGGG + Intergenic
1119037445 14:71242289-71242311 CTGCAGGGAGAGGCTGGACAAGG - Intergenic
1119741290 14:77015275-77015297 CTGCTGTGGCTGGTGGGAGAGGG + Intergenic
1120134567 14:80851172-80851194 TTTCTGGGACAGGTAGTACAGGG - Intronic
1120398733 14:84001517-84001539 CTGCTGGCAGAGGCAGGACAAGG + Intergenic
1121043744 14:90773084-90773106 CTTCAGGGACAGGAGGGGCAAGG + Intronic
1121138565 14:91520839-91520861 CAACTGGGACAGTTGGGAGAGGG - Intergenic
1122265413 14:100544514-100544536 CTGCTGGGACATGTCGAAGAGGG - Intronic
1122282891 14:100634654-100634676 CTGCTGCTACAGGTGGGCCTTGG - Intergenic
1122859543 14:104576369-104576391 GTGCTAGGTCAGGAGGGACAAGG - Intronic
1122888395 14:104721724-104721746 CTGCCTGGAGAGGTGGGACTGGG + Intronic
1125541463 15:40472055-40472077 AGGCTGGCACAGGTGGTACACGG - Exonic
1125675275 15:41498875-41498897 CTGCTGGGGCAGTTGGAACTTGG + Intronic
1126760352 15:51964236-51964258 TTGCAGGGACATGAGGGACATGG + Intronic
1128519260 15:68364767-68364789 CCGCTCGGACACGTTGGACAGGG + Exonic
1128522847 15:68386902-68386924 AAGCAGGGAGAGGTGGGACAGGG + Intronic
1129263432 15:74381640-74381662 CTGCTGGGACTGGTAAGTCATGG + Intergenic
1129294385 15:74591872-74591894 CTCCTGGGACTGGTGGGGCAGGG + Intronic
1130142873 15:81245594-81245616 CTGCTGGCATGGGTGGGACAGGG + Intronic
1131727967 15:95247886-95247908 CTTCTGGGTCAGGTGGCACTTGG - Intergenic
1132069972 15:98767803-98767825 CTGCTGGTGCCGGTAGGACAGGG + Intronic
1132626647 16:894544-894566 CTGCAGGCGCAGGTGCGACAAGG + Intronic
1132855501 16:2042917-2042939 CTGCGGGGACAGGAGGGGAATGG - Intronic
1132899024 16:2243440-2243462 CTGCAGGGAGAGGCCGGACAGGG + Intronic
1132906227 16:2284126-2284148 CTGCTGTGGGAGGTGGGGCAAGG + Intronic
1133737740 16:8628832-8628854 CTGCTGAGACAGGCAGCACAGGG + Exonic
1134163973 16:11915612-11915634 CTGCTGGGACCAGGCGGACATGG - Exonic
1136280392 16:29205321-29205343 CTCCTGGAACAGGTGGCAGATGG - Intergenic
1136515437 16:30765339-30765361 GTGCTGGGGCAGGTGAGGCAAGG + Intronic
1136748958 16:32615967-32615989 CTCCTGGGAAAGGTGTGAGAGGG + Intergenic
1136760479 16:32727812-32727834 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1136807624 16:33142574-33142596 GTGCTGGGTCAGCTGGGCCAGGG + Intergenic
1137614112 16:49836859-49836881 CTACTGGGACGTGTTGGACAAGG - Intronic
1138143718 16:54589670-54589692 CTGCTGGGGAGGGTGGGGCAGGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138853866 16:60663586-60663608 ATGCTGGGAGAGGTGGTAAAAGG - Intergenic
1141665578 16:85463585-85463607 TTGCTTGCACAGGTGGGACCTGG + Intergenic
1141680562 16:85541435-85541457 CAGCTGGGGCAGTGGGGACACGG - Intergenic
1141794388 16:86260315-86260337 CAGCTGAGTCAGGTGGTACAGGG + Intergenic
1142084761 16:88171279-88171301 CTCCTGGAACAGGTGGCAGATGG - Intergenic
1142122117 16:88391621-88391643 CTCTTGGGACAGGTGGGGCCGGG + Intergenic
1203051091 16_KI270728v1_random:875181-875203 CTCCTGGGAAAGGTGTGAGAGGG + Intergenic
1203062632 16_KI270728v1_random:988127-988149 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1142611051 17:1109363-1109385 CTGCGGGGCCGGGCGGGACACGG - Intronic
1145284563 17:21495700-21495722 CAGCTGGGAGAAGGGGGACACGG - Intergenic
1146230710 17:31105862-31105884 CTGCTGGTGGGGGTGGGACACGG - Intronic
1146283461 17:31559548-31559570 CTGCTGCGAGAGGTCGGCCACGG + Intergenic
1147444533 17:40466778-40466800 CTGATGGGAGGGGTGGGACGGGG + Intergenic
1148074191 17:44926260-44926282 CTGATGAGACAGGTGGGAGGTGG - Intronic
1148199399 17:45739968-45739990 CTCCTGGGACAGTTGGGAACAGG + Intergenic
1148520136 17:48265808-48265830 CTCCTGTGGCAGGTGGAACAGGG + Intronic
1148618407 17:49016713-49016735 CTACTGGGAGATGTGGGACTGGG - Intronic
1148702556 17:49598298-49598320 TTGGTGGGACAGGTGAGATATGG - Intergenic
1148755606 17:49971572-49971594 CTGCTGGGAGAGTTGGGGCGCGG + Intronic
1149521815 17:57323496-57323518 CTGCAGGGACAGGAGGGCAAAGG - Intronic
1149963699 17:61140394-61140416 CTGGTGGGAGATGTGGAACAGGG + Intronic
1151475883 17:74344200-74344222 CTGACGGGACAGGTGGGGGAGGG - Intronic
1151551470 17:74824864-74824886 CGACAGGGAGAGGTGGGACATGG + Intronic
1151657379 17:75502304-75502326 CAGCCGGGGCAGGTGGGCCAGGG + Exonic
1151665826 17:75544675-75544697 CTGTTGGGAGAGGTGGGTCGTGG + Intronic
1151784164 17:76266791-76266813 CTGCTGGGGGAGGAGGGGCAGGG + Intronic
1151999292 17:77635321-77635343 CCTCTGGTACTGGTGGGACATGG - Intergenic
1152789019 17:82268303-82268325 CCGGTGGGCGAGGTGGGACAGGG - Intronic
1152809045 17:82372414-82372436 CTGCTCGGCCTGGTGGGAAAGGG + Intergenic
1152809049 17:82372423-82372445 CTGGTGGGAAAGGGCGGACAGGG + Intergenic
1156251998 18:35360257-35360279 TTGCTGGGGCAGGTGGGGGAGGG + Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1157591322 18:48837841-48837863 CTGCTGGGACAGGTTGGTGGGGG - Intronic
1158135642 18:54204856-54204878 TTGCTGGGACAGGGTGGGCAGGG + Intronic
1158259661 18:55592647-55592669 CTGCTGGGGCTGGTGGGGCTGGG - Intronic
1159607903 18:70494595-70494617 CTGCTGGGACAGGTCTTTCAAGG - Intergenic
1160350781 18:78176542-78176564 TTGCTAGGCAAGGTGGGACATGG + Intergenic
1160556063 18:79726105-79726127 ATGCTGGGACAGCAGGGACACGG + Intronic
1160558340 18:79740191-79740213 CGGCCGGGACGGGTGGGACTCGG + Intronic
1160780905 19:877659-877681 CTGCTGGGGCACGTGGGTCTGGG - Intronic
1160780921 19:877715-877737 CTGCTGGGGCACGTGGGGCAGGG - Intronic
1160780947 19:877789-877811 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160780962 19:877845-877867 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160780979 19:877901-877923 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781001 19:877969-877991 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781019 19:878031-878053 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781059 19:878181-878203 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781101 19:878305-878327 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781123 19:878373-878395 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781150 19:878447-878469 CTGCTGGGGCACGTGGGGCCGGG - Intronic
1160781167 19:878503-878525 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781186 19:878565-878587 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160781203 19:878627-878649 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781256 19:878795-878817 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781281 19:878863-878885 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1160781352 19:879073-879095 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781377 19:879141-879163 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781399 19:879229-879251 CTGCTGGGGCATGTGGGGCTCGG - Intronic
1160781418 19:879317-879339 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781449 19:879429-879451 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781466 19:879485-879507 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781502 19:879621-879643 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781518 19:879677-879699 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781542 19:879765-879787 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781585 19:879909-879931 CTGCTGGGGCACGTGGGGCCGGG - Intronic
1161221558 19:3120375-3120397 CTCTGGGGACTGGTGGGACAGGG - Intronic
1161304031 19:3557195-3557217 CTGCTGGGCCAGGTGGCCGACGG - Exonic
1161424372 19:4194684-4194706 CTGCTGGGGGAGAAGGGACAAGG + Intronic
1161687817 19:5712071-5712093 CTGGTGGCACAGGTGGTCCAAGG + Intronic
1161855661 19:6763557-6763579 CTATTGGGACAGGTGGCAGAGGG - Intronic
1162123739 19:8487989-8488011 GTTCTGGGACAGGAGGGAGATGG - Intronic
1162639881 19:11999926-11999948 CTGGCGGGGCTGGTGGGACAAGG + Intergenic
1162964993 19:14151352-14151374 CCCCTGGCACAGGTGGCACAGGG + Exonic
1163424940 19:17236073-17236095 AGGCGGGGACAGGAGGGACATGG + Intronic
1163658900 19:18564801-18564823 CTTCTGGGCCAGGTTGGGCAGGG + Intronic
1163679848 19:18674845-18674867 CTCCTGGGACAGCTGGGGAATGG - Intergenic
1164456789 19:28414502-28414524 GTAGTGGGACAGGTGGGGCAGGG - Intergenic
1165010224 19:32840636-32840658 CTGCTGGGAGAGAAAGGACATGG - Intronic
1165258236 19:34592796-34592818 CTCCTGGGGCTGGTGGGACCAGG - Intergenic
1165895022 19:39136300-39136322 CTGCTGGGAGAGGTGGAGCCAGG - Intronic
1165990855 19:39812608-39812630 CAGCTGGTCAAGGTGGGACAGGG + Intergenic
1166732421 19:45066738-45066760 CTTGGGGGACAGGTGGGACCTGG + Intronic
1167436477 19:49481381-49481403 CTCCTGGGACAGGAAGGAAATGG + Intronic
1168311686 19:55463907-55463929 CTCCTGGGACAGGATGGAGAGGG + Intergenic
925084697 2:1099134-1099156 CTGCTGGACCAGGTGGGAGGAGG - Intronic
925157441 2:1658533-1658555 GTGCTGGGCCAAGTGGGAGAAGG - Intronic
925302307 2:2826137-2826159 AGGCTGGGACACGTGGCACAGGG + Intergenic
925764556 2:7218633-7218655 CTGCTGGGAAGCGTGGGAGAGGG - Intergenic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
925866471 2:8232377-8232399 ATGCTGGAACTGGTGGGACAGGG - Intergenic
926197531 2:10772842-10772864 CTGCTCGGCCAGGTGGGGCCAGG - Intronic
927313753 2:21658438-21658460 CTGCTGCTCCAGGTGGGATATGG - Intergenic
927486454 2:23491601-23491623 CTGCTGGGACAGGGATGAAAGGG - Intronic
927716334 2:25355786-25355808 GTGCTGGGACAGCTGGGATTCGG - Intergenic
927936144 2:27078012-27078034 CTGCTGGGCCAGGGAGGAAAAGG - Intergenic
929054261 2:37862625-37862647 CTGCTGAGACTGGAGGAACATGG + Intergenic
930707476 2:54519164-54519186 CTGCCTGGACAGGTGGCAGAGGG - Intronic
932099752 2:68887638-68887660 CTGGAGGGGGAGGTGGGACAGGG + Intergenic
932880075 2:75493162-75493184 CTGCAGGGACAGTGGGCACAAGG - Exonic
934039301 2:88114845-88114867 ATGCTGGGCCAGGAGGGGCAGGG - Intergenic
934119021 2:88822554-88822576 CTGTTGTGAAAGGTAGGACAGGG - Intergenic
936162473 2:110094906-110094928 CTGTTGTGAAAGGTAGGACAAGG - Intronic
936182187 2:110276460-110276482 CTGTTGTGAAAGGTAGGACAAGG + Intergenic
936228594 2:110680099-110680121 CTCCTGGGAAAGGTGTGAGAAGG - Intergenic
937701258 2:124865608-124865630 ATGCTGATACTGGTGGGACATGG - Intronic
938239067 2:129728861-129728883 ATGCTGGGCCAGGTGGCACCAGG + Intergenic
938267188 2:129936441-129936463 CAGAAGGGACAGGAGGGACAGGG + Intergenic
939877543 2:147595080-147595102 GTGATGGGGCAGGTGGGAGAGGG - Intergenic
939996863 2:148927902-148927924 TTGGTGGGAGAGGAGGGACAGGG - Intronic
940318721 2:152351348-152351370 CTGCTGGGATTGGTGGGAAAGGG - Intronic
941308294 2:163897894-163897916 CTGCTGTGACAGCCAGGACAGGG + Intergenic
942249489 2:174035171-174035193 CTGCTGGGACGTGGGGGACCTGG + Intergenic
942408898 2:175685866-175685888 GTGCTGTGCTAGGTGGGACATGG - Intergenic
943360367 2:186911757-186911779 CTGCTGGCTGAGGAGGGACAAGG - Intergenic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
943445983 2:187988499-187988521 CACCTGGCACAGGTGGTACAAGG - Intergenic
943731157 2:191305222-191305244 TTGCTGGGACTGGTGTGGCAGGG + Intronic
945080819 2:206085395-206085417 CTGCCGGGACAGGGGCGTCAGGG - Intronic
946026232 2:216673425-216673447 CTGCTTTGCCAGGTGGGTCAGGG + Exonic
947545006 2:231004301-231004323 CTGTTGGGAGAGGTGAGATAAGG + Intronic
947646868 2:231748754-231748776 CGGCTGGAGCAGCTGGGACATGG - Intronic
948147452 2:235718600-235718622 ATGCTAGGACAGGTGTTACAGGG - Intronic
948189453 2:236046533-236046555 TAGCTGGGACAGGAGGGACCTGG + Intronic
948214746 2:236220340-236220362 CAGCTGAGACAGGTGGGAGCAGG - Intronic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
1168890689 20:1293847-1293869 TGGCAGGGACAGCTGGGACAAGG + Intronic
1168960277 20:1864311-1864333 CAGCTGGGACAGGTGGGTCATGG + Intergenic
1170475589 20:16711081-16711103 CTTCTGGGAAAGGTGGCACCAGG - Intergenic
1170684807 20:18559541-18559563 TTGCTGGTTCAGGTGGGTCAGGG + Intronic
1170962445 20:21037392-21037414 CTGCAGGGCCAGGAGGGGCAGGG + Intergenic
1172273900 20:33669583-33669605 CTGATGGGACAGGTTGGGCTGGG - Intronic
1172387106 20:34541711-34541733 CTTCTGGGGCAGGGAGGACAAGG - Intergenic
1172448667 20:35006573-35006595 GTGCTGGGTGAGGAGGGACAGGG + Exonic
1172764724 20:37345549-37345571 GGGCTGGGGCAGGAGGGACAGGG - Intronic
1173176850 20:40771250-40771272 CTGCAGGGACAGGAGGCACTTGG - Intergenic
1173263862 20:41460509-41460531 TGGCTGGAACAGTTGGGACAGGG - Intronic
1173600946 20:44294772-44294794 CTGATGGGTCAGGTTGGAGATGG + Intergenic
1174329202 20:49804433-49804455 TGGCTGGGGCAGGTGGGAGACGG + Intergenic
1175250696 20:57608764-57608786 TTGCTGGGACAGCAAGGACACGG + Intronic
1175335530 20:58193505-58193527 CTCCTGTGAGACGTGGGACAGGG + Intergenic
1175968698 20:62673134-62673156 CTGCTGTGACTGCTGGGCCAGGG + Intronic
1176169823 20:63691758-63691780 CTTCTCAGACAGGAGGGACAGGG - Exonic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1176307430 21:5131201-5131223 TTGCTGGCCCAGGTGGCACAAGG + Exonic
1178409354 21:32350770-32350792 CTGCATGGACAGGTGTGGCATGG + Exonic
1179026443 21:37682842-37682864 CTGCAGGGACAGATGGCCCAGGG - Intronic
1179532448 21:42029095-42029117 CCTCTGGGACAGGTGGCACCAGG - Intergenic
1179849630 21:44130829-44130851 TTGCTGGCCCAGGTGGCACAAGG - Exonic
1179877212 21:44275182-44275204 CAGGTGGGGCAGGTGGGGCAGGG - Intergenic
1179877245 21:44275296-44275318 CAGGTGGGGCAGGTGGGGCAGGG - Intergenic
1180076723 21:45466915-45466937 CAGCTTGGACATGTGGGACCAGG + Intronic
1180148462 21:45935155-45935177 CTCCTGGGTCAAGTGAGACAGGG - Intronic
1180245577 21:46545396-46545418 CTGCTGGGGCTGTTGGCACATGG + Intronic
1180247497 21:46557914-46557936 CTGCAGAGACAGGTGGGCCGTGG - Intronic
1180707685 22:17819102-17819124 CGGCAGGGACAGGTGGGAGTTGG + Exonic
1181151340 22:20885584-20885606 CTGCTGGCAGAAGTGGGAGAAGG + Intronic
1181266875 22:21635625-21635647 CTGCTAGGAGTGGTGGGTCAAGG - Intronic
1181601422 22:23954019-23954041 CTGCTGGGCCATGTGGCAGACGG + Intergenic
1181607085 22:23987318-23987340 CTGCTGGGCCATGTGGCAGAAGG - Intergenic
1182103412 22:27672603-27672625 CTTCTGGGAGAGCTGGGCCAGGG - Intergenic
1182269430 22:29144294-29144316 CTGCAGGGAGAGGTGGCACTCGG + Intronic
1182420419 22:30246037-30246059 ATGCTGGAACAGCGGGGACAGGG + Intronic
1182841062 22:33390464-33390486 CTGCTGGCACAGGAAGCACAGGG - Intronic
1183079886 22:35449589-35449611 CGGCTGGGACAGAGGGGCCACGG - Intergenic
1183279063 22:36922570-36922592 CTGCTGGGGAAGGAGGGGCAGGG - Intronic
1183353688 22:37347488-37347510 CTGCTGGGGCAGAAGTGACATGG - Intergenic
1184259681 22:43307480-43307502 CTGCTGGGACAAGGAGGACACGG + Intronic
1184651153 22:45920037-45920059 CTGCGGGGACAGGAGGGCCATGG - Intergenic
1184664053 22:45978276-45978298 AGGCTTGGCCAGGTGGGACAGGG - Intergenic
949173385 3:1030067-1030089 CTGTTGGGAGATGTGGGGCACGG - Intergenic
949905853 3:8857897-8857919 CTGCTGGGTCATGTGGCGCAAGG - Intronic
949928023 3:9057538-9057560 CTGCTGGGAGGGGAGGGGCAAGG - Intronic
950280946 3:11707466-11707488 CAGCTGGGACATGAGGGACGGGG + Intronic
953891281 3:46753460-46753482 CTGCTCTGCCAGGTGGGCCACGG - Intronic
954362028 3:50127027-50127049 CGGCTGGGTCTGTTGGGACAAGG + Intergenic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954710341 3:52502300-52502322 CTGAAGGGACAGGTGGGAGCTGG - Intronic
954718308 3:52538256-52538278 CTGGTGGGACACCTGGGGCAGGG + Intronic
955061022 3:55491558-55491580 CTGCTGGGAAAGGCGGCACAGGG - Intergenic
956177262 3:66484641-66484663 TGGCTGGGACAGGTGGGGCCAGG + Intronic
957191378 3:77014487-77014509 CTGCTGGGATCGGCGTGACATGG - Intronic
959943981 3:112108388-112108410 TTGCTGGGAGGGGTGGGAAAGGG + Intronic
960785789 3:121371894-121371916 CCGCTGGGAGAAGTGGGACAAGG + Intronic
960936517 3:122907484-122907506 CTGCTGAGCCAGCTGGGACAAGG + Intergenic
960970022 3:123132763-123132785 CTGCTGTCACGGCTGGGACAGGG - Intronic
961010685 3:123433768-123433790 CTGGTGGCATAAGTGGGACAGGG - Intronic
961662595 3:128477560-128477582 GGGCTGGGGCAGCTGGGACAAGG + Intergenic
967755906 3:193168213-193168235 CTGCTTGGCCAGGTGGTACAAGG + Intergenic
967947780 3:194817880-194817902 CTGCTGGCTCTGGTGGGAAAGGG - Intergenic
968222391 3:196948447-196948469 CGGCGGGGCCAGGTGGTACACGG + Exonic
968286135 3:197509976-197509998 CTCCTGGGGCAGCTGGGACAGGG + Exonic
968453583 4:686425-686447 CTGTTGGGACTGGTGGGCCCCGG + Intronic
969176021 4:5399702-5399724 CTGCTGGGAAGGCTGAGACACGG - Intronic
969297910 4:6280437-6280459 CTGCTGGGTCACCTGGGACCAGG - Intronic
969822233 4:9729584-9729606 CTGGTTGGATAGGTGGGGCATGG + Intergenic
970252150 4:14127683-14127705 TAGCTGGGACAGGTGGGAGGAGG - Intergenic
970500416 4:16671479-16671501 CTGCTGAGACAGTAGGGACCTGG - Intronic
972723834 4:41728195-41728217 CTGCTGGGAAAAGTGGGAGCAGG + Intergenic
973621892 4:52735169-52735191 CTGCTGGTAGAGGTTGGGCATGG - Intronic
973989559 4:56390242-56390264 CTGGTGGGACTTGGGGGACATGG + Intergenic
977570710 4:98626584-98626606 CTGCTGCACCAGGTGGGCCAGGG - Intronic
982121277 4:152145747-152145769 CAGCTGGAGCAGCTGGGACATGG + Intergenic
982525354 4:156470964-156470986 CTCCTGGGGCAGATGGGGCATGG + Intergenic
982597798 4:157407192-157407214 CTGCTGGGTCATGTGGCCCAAGG + Intergenic
985749329 5:1665436-1665458 CTGCAGGGCCAGGCGGGACAGGG - Intergenic
985772369 5:1820887-1820909 CTGCTGGGACCGGGGTGACCAGG + Intergenic
985875730 5:2592375-2592397 CTGCAGGGCCAGGCAGGACATGG - Intergenic
986707552 5:10464072-10464094 CGGCTGGGACAGGTGGGGCAGGG - Intronic
988058466 5:26133550-26133572 CTGTTGGGGCATGGGGGACAAGG - Intergenic
988280086 5:29134253-29134275 CTGCTGGAACAGGGAGGGCAAGG + Intergenic
988631966 5:32941144-32941166 GTGCTGGGACACATGGAACATGG + Intergenic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
990308881 5:54518944-54518966 CTTCTCGGGCAGGTGGGGCACGG - Exonic
994733655 5:103524796-103524818 CCGCTGGGAGAGGTAGGACAGGG + Intergenic
995090945 5:108176050-108176072 CTCCTGGGAGAAGTGGGAGATGG + Intronic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
996453730 5:123656404-123656426 GAGCTGGAACAGCTGGGACACGG + Intergenic
998536067 5:142932024-142932046 CTGCAGAGAAAGGAGGGACATGG - Intronic
999197519 5:149792442-149792464 CTTTTGGGAGTGGTGGGACAGGG + Intronic
999205827 5:149847269-149847291 CTGCTGGGACATCTTGGCCATGG - Intronic
999343985 5:150798494-150798516 CAGCTGGGAGAGCTAGGACAGGG + Intergenic
999372592 5:151064825-151064847 GCGCTGGGCCAGGAGGGACAGGG + Intronic
1001886083 5:175291613-175291635 CTGCTGTGGCACTTGGGACAAGG - Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1001990853 5:176114369-176114391 CTCCTGGGAAAGGTGTGAGAGGG + Exonic
1001997598 5:176174647-176174669 CTGCTGGGAAAGGTGTGAGAGGG - Intergenic
1002226021 5:177723771-177723793 CTCCTGGGAAAGGTGTGAGAGGG - Exonic
1002267825 5:178047439-178047461 CTCCTGGGAAAGGTGTGAGAGGG + Exonic
1002581767 5:180212979-180213001 CTGCTGGGACTGTGGGGCCAGGG + Intergenic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1006084669 6:31587428-31587450 CAGCTGGTACAGGAGGGAAAGGG + Intronic
1006503526 6:34473421-34473443 CTTGTGGGACAGGTGGCCCAGGG + Intronic
1007009348 6:38400171-38400193 CTGATGGGACAGGTAGAAGAAGG - Intronic
1007485184 6:42175970-42175992 TTGCGGGGAAAGGTGGGACTAGG - Intronic
1007902332 6:45423156-45423178 CAGCGGGCACAGGTGGGAGAGGG - Intronic
1008544440 6:52573391-52573413 CTTTTGGGAGAGGTGGCACAGGG - Intronic
1009333584 6:62457149-62457171 CTTCTGGGGCATGTGGGAAAAGG - Intergenic
1010015059 6:71095405-71095427 CTGAGGGGACAGTTGGGAGAGGG - Intergenic
1010265186 6:73857692-73857714 CTGCTGCCACAAGTGGCACATGG - Intergenic
1014843880 6:126252211-126252233 GAGCTGGGACAGCTGGGACTTGG + Intergenic
1015374105 6:132490747-132490769 CTGCTGGAGAAGGTGGGAAAAGG + Intronic
1017778589 6:157698844-157698866 CTGATTGGTCAGGTGGGAGATGG + Intergenic
1017962543 6:159234009-159234031 CTGCTGGGACTTGGAGGACAGGG - Exonic
1018164655 6:161081820-161081842 CTGATGAGACAAGTGGGAGAAGG - Intronic
1018686754 6:166309337-166309359 CTGCTGTGACTGTTGGCACAGGG - Intergenic
1018910230 6:168097468-168097490 CTGACGGGACAGGTGGGGCCAGG + Intergenic
1019116856 6:169772061-169772083 GTGGTGGCACAGGAGGGACAGGG - Intronic
1019156014 6:170039507-170039529 ATGGTGGGACAGCAGGGACATGG - Intergenic
1019156051 6:170039636-170039658 ATGGTGGGACAGCAGGGACACGG - Intergenic
1019156075 6:170039731-170039753 ATGGTGGGACAGCAGGGACACGG - Intergenic
1019156095 6:170039807-170039829 ATGGTGGGACAGCAGGGACACGG - Intergenic
1019495967 7:1340870-1340892 GTGATGGGACAGGTGGGTCCTGG - Intergenic
1019501180 7:1365460-1365482 CGGTTGGGACAGGTGGACCAGGG - Intergenic
1019613346 7:1947876-1947898 TTCCTGGAATAGGTGGGACACGG - Intronic
1019890291 7:3941022-3941044 CTGGTGGGTCAGGAGGGAGAAGG - Intronic
1019991317 7:4693660-4693682 GTGATGGGGGAGGTGGGACAGGG + Intronic
1020316613 7:6909919-6909941 CTGGTTGGATAGGTGGGGCATGG - Intergenic
1020941377 7:14542739-14542761 CTGCCGGGACAGGAGACACATGG - Intronic
1021963495 7:25895119-25895141 AAGTTGGGACAGGTGGCACAAGG - Intergenic
1023396704 7:39758297-39758319 TAGCTGGGACTGGTTGGACAAGG + Intergenic
1023942084 7:44775697-44775719 CTGCAGGGTGAAGTGGGACATGG + Intergenic
1023966746 7:44966839-44966861 CTGCAGGGACAGAGGGGACTTGG + Intronic
1023989459 7:45119421-45119443 CTGCTGGGCCAGGTGCCACAAGG + Intergenic
1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG + Intronic
1024296011 7:47842856-47842878 CTGCTGTGACAGGTGACAGACGG + Intronic
1024589829 7:50871717-50871739 CTGTCTGGAAAGGTGGGACAGGG + Intergenic
1025041104 7:55646471-55646493 CTGCTGGGTAAGTTGGGGCACGG - Intergenic
1025198452 7:56948736-56948758 CGGCTGGGAGAGGTGGGGCCTGG - Intergenic
1026737604 7:72959120-72959142 GAGCTGGGAGAGGTGGGAAATGG - Intergenic
1026788638 7:73317919-73317941 GAGCTGGGAGAGGTGGGAAATGG - Intronic
1027106129 7:75405948-75405970 GAGCTGGGAGAGGTGGGAAATGG + Intronic
1027327660 7:77060832-77060854 CTGCTGGGACAGGGAACACAGGG - Intergenic
1028582592 7:92423018-92423040 GTGCGGGGAAAGGTGGGATAGGG + Intergenic
1029113161 7:98223651-98223673 GTGCTGGGCCAGGTGAGGCAGGG - Exonic
1029438913 7:100576891-100576913 TAGCTGGACCAGGTGGGACAGGG - Exonic
1029657181 7:101934997-101935019 CTGCTGGGACAGATCCGACTTGG + Intronic
1030658131 7:112190874-112190896 CTCCTTGGACAGGTAGGACAGGG + Intronic
1032373699 7:131386996-131387018 CTGCTAGTACAGGATGGACAAGG + Intronic
1032416706 7:131741030-131741052 CTGCTGGGAGAGGGGAGACGGGG + Intergenic
1032446580 7:131989379-131989401 CTGCTGGGAGAGGGGGGAAATGG + Intergenic
1032517935 7:132520771-132520793 CTGTTGGGGCAGCTGTGACAGGG - Intronic
1032650118 7:133868965-133868987 CTGCTGGGAGAGGCAGGGCAGGG - Intronic
1032884457 7:136123148-136123170 TTGCAGGGAGGGGTGGGACAGGG - Intergenic
1033350499 7:140558340-140558362 GGACAGGGACAGGTGGGACAGGG - Intronic
1033449524 7:141450003-141450025 CTACTGGGACAGGCAGGAAATGG + Intronic
1034200547 7:149280849-149280871 CTGCTGGGACAGCAGTGACAAGG - Intronic
1034276351 7:149825507-149825529 CTGCTGGGTCATGAGTGACAGGG + Intergenic
1034513882 7:151558524-151558546 CGGGTGGGACAGCTGGGACTTGG + Intronic
1034657554 7:152741538-152741560 GTGCTGGGGCAAGAGGGACAAGG + Intergenic
1034815669 7:154170184-154170206 CTGCTGGGTCAGCTGCGGCAAGG - Intronic
1034959292 7:155355112-155355134 CTGCTGGGAAGGCAGGGACATGG + Intergenic
1034965626 7:155388956-155388978 CAGGTGGGGCAGGTGGGCCAGGG + Intronic
1035022477 7:155807703-155807725 CTGCTGCTGCTGGTGGGACATGG + Intronic
1035466510 7:159083109-159083131 CAGGTAGGACAGGTGGGACCAGG - Intronic
1036662303 8:10716178-10716200 CTGCTGGGACAGGGCGGGGAAGG + Intergenic
1037892585 8:22631283-22631305 CAGCTGGTACAGGCGGGACTGGG + Intronic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1040022686 8:42754921-42754943 GTGCTGGGAGATGTGGGAGAGGG - Intronic
1042467665 8:69146600-69146622 GTGGTGGGACAGGGTGGACATGG + Intergenic
1047015282 8:120717665-120717687 CTCCTGGCACAGATGGGAAATGG + Intronic
1047671493 8:127152052-127152074 CTCCTGGGACAGATGGGTGATGG - Intergenic
1048734119 8:137479337-137479359 GTGCTGGTACAGGTGGAAAATGG + Intergenic
1048879559 8:138861184-138861206 CTGCTGGGACAGGGGCCTCAGGG + Intronic
1048996018 8:139794158-139794180 CTCCTGGGGCAGGTGGCACGGGG - Intronic
1049224439 8:141443090-141443112 CTGCTGGGGCTGCAGGGACAAGG - Intergenic
1049229846 8:141476278-141476300 CTGCAGAGGCAGGTGGGCCAGGG - Intergenic
1049835177 8:144730693-144730715 CTGCCGGGCCAGGTCAGACATGG + Intronic
1052786230 9:32831011-32831033 CTGCTAGGAGTGGTGGGAGAGGG + Intergenic
1053141931 9:35688046-35688068 CTGGAGGGGCAGGGGGGACAGGG - Intronic
1053142192 9:35689269-35689291 CAGCTGGGACAGAGGGGACTTGG + Exonic
1053273066 9:36763202-36763224 CTGCTGGGAGTGGAGGAACAGGG + Intergenic
1053449324 9:38180004-38180026 CTGCTGGGCCAGCAGGGAGATGG + Intergenic
1058174506 9:101722125-101722147 CAGCTGGAGCAGCTGGGACACGG - Intronic
1059418453 9:114176238-114176260 CACCTGGGACAGTTGGGTCAAGG + Intronic
1060212562 9:121719498-121719520 CTGCAGTGAGAGGTGGGAAAGGG + Intronic
1060817902 9:126645024-126645046 CCGCTGGGCCAGGTGGGACAGGG - Intronic
1060891987 9:127194954-127194976 CAGCTGTCACAGGTGGGGCAAGG - Intronic
1061005903 9:127928279-127928301 GTCCTGGGACAGGAGGGTCAGGG + Intronic
1061043617 9:128152968-128152990 CAGCTGGGCCAGGTGGGGCAGGG + Intronic
1061147096 9:128806383-128806405 CTGCTGCGACAGGCTGGGCAGGG + Intronic
1061804311 9:133129453-133129475 CTGCTGTGACAGGCAGGACCAGG + Intronic
1061912806 9:133733910-133733932 CAGCTTGGCCAGGTGGTACAGGG + Exonic
1061920402 9:133779401-133779423 CTGCTGGGCCAGGCGGGAGCTGG - Intronic
1062535237 9:137018464-137018486 GTCCAGGGAAAGGTGGGACAGGG + Intronic
1062572043 9:137190235-137190257 CTGCTGGCTGAGGAGGGACAAGG - Exonic
1185530820 X:816987-817009 TTACTGGGAGAGGTGGGACTGGG + Intergenic
1187987135 X:24826506-24826528 CTGCTGGGCCAGGTAGTACTGGG - Exonic
1188024457 X:25194185-25194207 CTGTTGGGAGTGGAGGGACAAGG + Intergenic
1189323934 X:40101846-40101868 GTACTGGAACAGGTGGGACTCGG + Intronic
1189729479 X:44004148-44004170 CTGTTGGGACATTTGGGACATGG - Intergenic
1190964200 X:55282099-55282121 CTGTGCGGAGAGGTGGGACAAGG + Intronic
1191919757 X:66242815-66242837 CTGCTCTGACAGGTGTGAGATGG - Intronic
1192698898 X:73447330-73447352 CAGCTGGGACAGGCGGCACAGGG + Exonic
1193392797 X:80948969-80948991 CTGCTGGCAGTGGTGGTACAGGG + Intergenic
1193430145 X:81392057-81392079 CTGGTGGAACAGCTGGGAGATGG + Intergenic
1195869666 X:109472900-109472922 CTGGTGGGTGAGGTGTGACAGGG - Intronic
1198972914 X:142301676-142301698 CTGCTAGAACATTTGGGACAAGG + Intergenic