ID: 948739962

View in Genome Browser
Species Human (GRCh38)
Location 2:240039849-240039871
Sequence GTTCAGCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948739962_948739964 5 Left 948739962 2:240039849-240039871 CCTACAGCATGGTGCTGCTGAAC No data
Right 948739964 2:240039877-240039899 CACTGATTTGACATCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948739962 Original CRISPR GTTCAGCAGCACCATGCTGT AGG (reversed) Intergenic