ID: 948744142

View in Genome Browser
Species Human (GRCh38)
Location 2:240073766-240073788
Sequence GAAAGTCAACACTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948744142_948744147 -10 Left 948744142 2:240073766-240073788 CCCTCCTCAGAGTGTTGACTTTC No data
Right 948744147 2:240073779-240073801 GTTGACTTTCATGCTCAGGGTGG No data
948744142_948744148 1 Left 948744142 2:240073766-240073788 CCCTCCTCAGAGTGTTGACTTTC No data
Right 948744148 2:240073790-240073812 TGCTCAGGGTGGTTGACTCATGG No data
948744142_948744149 12 Left 948744142 2:240073766-240073788 CCCTCCTCAGAGTGTTGACTTTC No data
Right 948744149 2:240073801-240073823 GTTGACTCATGGCATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948744142 Original CRISPR GAAAGTCAACACTCTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr