ID: 948748568

View in Genome Browser
Species Human (GRCh38)
Location 2:240113406-240113428
Sequence GCCCGGAGGCTGCTGGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948748556_948748568 4 Left 948748556 2:240113379-240113401 CCCGATCTGATTCCTTAGCCCTT No data
Right 948748568 2:240113406-240113428 GCCCGGAGGCTGCTGGGCAAGGG No data
948748557_948748568 3 Left 948748557 2:240113380-240113402 CCGATCTGATTCCTTAGCCCTTG No data
Right 948748568 2:240113406-240113428 GCCCGGAGGCTGCTGGGCAAGGG No data
948748561_948748568 -8 Left 948748561 2:240113391-240113413 CCTTAGCCCTTGGGTGCCCGGAG No data
Right 948748568 2:240113406-240113428 GCCCGGAGGCTGCTGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948748568 Original CRISPR GCCCGGAGGCTGCTGGGCAA GGG Intergenic
No off target data available for this crispr