ID: 948748625

View in Genome Browser
Species Human (GRCh38)
Location 2:240113767-240113789
Sequence GCTTAGGTGTCAGCAGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948748619_948748625 -2 Left 948748619 2:240113746-240113768 CCAAAGCATCCTCCCAAAGTGGC No data
Right 948748625 2:240113767-240113789 GCTTAGGTGTCAGCAGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948748625 Original CRISPR GCTTAGGTGTCAGCAGGAAT AGG Intergenic
No off target data available for this crispr