ID: 948749201

View in Genome Browser
Species Human (GRCh38)
Location 2:240120526-240120548
Sequence CAAACATCTCCCCTTCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948749201_948749202 11 Left 948749201 2:240120526-240120548 CCAATTTGAAGGGGAGATGTTTG No data
Right 948749202 2:240120560-240120582 AGTTTTGAGAGTTCTTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948749201 Original CRISPR CAAACATCTCCCCTTCAAAT TGG (reversed) Intergenic
No off target data available for this crispr