ID: 948751348

View in Genome Browser
Species Human (GRCh38)
Location 2:240135203-240135225
Sequence CTGGGTTGGGGGATGCCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948751348_948751355 -6 Left 948751348 2:240135203-240135225 CCAGTCGGCATCCCCCAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 948751355 2:240135220-240135242 ACCCAGGGCTCTGCTCCTGCCGG 0: 1
1: 1
2: 6
3: 53
4: 419
948751348_948751357 -5 Left 948751348 2:240135203-240135225 CCAGTCGGCATCCCCCAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 948751357 2:240135221-240135243 CCCAGGGCTCTGCTCCTGCCGGG 0: 1
1: 0
2: 11
3: 83
4: 637
948751348_948751361 16 Left 948751348 2:240135203-240135225 CCAGTCGGCATCCCCCAACCCAG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 948751361 2:240135242-240135264 GGCCTTCATCCCCCACTACCTGG 0: 1
1: 0
2: 0
3: 22
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948751348 Original CRISPR CTGGGTTGGGGGATGCCGAC TGG (reversed) Intronic
900363014 1:2298990-2299012 CTGGGTGGGTGGATGCCGGGTGG + Intronic
901653423 1:10755852-10755874 CTGGGGTGGGGGGTGCAGAGGGG - Intronic
902918922 1:19655215-19655237 GTGGGTGGGGGGATGCGGACAGG + Intronic
903572650 1:24317934-24317956 CTGTGTTGGGGGAAGCCCAGGGG - Intergenic
904046648 1:27613174-27613196 CTGGGGTGGGGGATGGTCACGGG - Intronic
909501967 1:76344893-76344915 CTTGGTTGGGGGGCGCCAACAGG - Intronic
910550138 1:88466023-88466045 CTGGGTTCTGGGATGCCGTGTGG + Intergenic
911154974 1:94628212-94628234 CTGGGATGGGAGATGCAGGCGGG + Intergenic
912542297 1:110426099-110426121 CTGGGTTGGGGGATGGCAGGGGG + Intergenic
913048092 1:115090082-115090104 CTGGGTTGAGGGCAGCCCACAGG - Intergenic
913199787 1:116486392-116486414 CAGGGTTGGGGAATGAAGACTGG + Intergenic
914800826 1:150961098-150961120 CCGGGCTGGGGGAAGCCGAATGG + Exonic
916786653 1:168091536-168091558 CTGGGTGGTGGGATGCAGGCAGG - Intronic
918427917 1:184429005-184429027 CTGGGTTGGGGGATGGAGCCAGG - Intronic
923665637 1:235996201-235996223 CTGTGCTGGGGGATGCACACAGG + Intronic
924936234 1:248773855-248773877 CAGGGTTGGGGGGTTCCGCCAGG - Intergenic
1069833293 10:71293986-71294008 CTGGGGTGGGGGATTCTGGCAGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1072618232 10:97063645-97063667 CTGGGCTGGGGGATCCAGATGGG - Intronic
1072740295 10:97905084-97905106 ATGGGTTGGGGGAGGGAGACTGG + Intronic
1073285115 10:102382804-102382826 CTGGGTGGGGGACTGCCCACAGG + Exonic
1075119154 10:119651652-119651674 CTGGGTTGGGGTCTGCCCGCTGG - Exonic
1075142056 10:119847206-119847228 CTGGACTGGGGGATGCAGAAGGG + Intronic
1075786460 10:125053420-125053442 CTGTGTTGGGGGATGCCAGGAGG - Intronic
1076273442 10:129176201-129176223 CTGGGCTGGAGGATGGAGACAGG + Intergenic
1076306800 10:129471062-129471084 CTGGGCTGGGGGACACCGAATGG + Intronic
1076680294 10:132168216-132168238 ATGGGATGGGGGCTGCCGTCCGG - Exonic
1077009269 11:372956-372978 CGGGGTTGGGGGGTGCCGGGTGG + Intronic
1077225930 11:1439175-1439197 CTGGGCTGGGGGCTGCCCTCAGG + Intronic
1077300355 11:1843895-1843917 CTGGGTTGGGGGGTGAGGAATGG + Intergenic
1081522556 11:43897277-43897299 CTGGGATGTGGGGTGGCGACGGG - Intronic
1082260593 11:50074083-50074105 CTGGGCCTGGAGATGCCGACTGG + Intergenic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1087203716 11:95372303-95372325 CAGGGTTGGGGGAAGCAGACAGG + Intergenic
1091096884 11:132831690-132831712 TTGTGTTGGGGGATGCTGAATGG - Intronic
1091981875 12:4871220-4871242 GAGGGTTGGGGAATGCTGACTGG - Intergenic
1092192473 12:6530993-6531015 CTGGGTGTTTGGATGCCGACGGG - Exonic
1096772615 12:53945606-53945628 CAGGGTTGGGGAATCCCGAATGG + Exonic
1096774493 12:53955768-53955790 CGGAGTTGGGGGATCCTGACGGG + Intronic
1100618185 12:96247695-96247717 CTGGGGTGAGGGATCCCGAGGGG - Exonic
1102443295 12:112979767-112979789 CTGGGTTTGGAGGTGCTGACTGG - Intronic
1102677775 12:114669655-114669677 CTGTGTGGGGGGTTGCCGAGTGG + Intergenic
1102776281 12:115522501-115522523 CTGGGTGGGTGCATGCTGACTGG - Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1110339028 13:74367258-74367280 GTGGGTTGCTGGATGCCAACAGG + Intergenic
1112670241 13:101627389-101627411 GTGGGGTGGGGGATGATGACAGG - Intronic
1114459815 14:22879146-22879168 CTGGGTTTGAGGAGGCTGACAGG - Exonic
1118718390 14:68576390-68576412 CTGGGTTGGGGGTGGCAGGCAGG - Intronic
1119684082 14:76616426-76616448 CTGTGTTGGAGGATGAGGACTGG - Intergenic
1120521126 14:85529732-85529754 CAGGGTTGGGGGATGTGGACGGG + Intergenic
1202904482 14_GL000194v1_random:60335-60357 CTGGGTTGGGGTAAGTCTACTGG - Intergenic
1124147251 15:27139259-27139281 CTGGTTTGGGGGGTGCAGAGAGG + Intronic
1125137218 15:36357741-36357763 CTGGGTTGGGTGATGACAATTGG - Intergenic
1131256245 15:90864568-90864590 TTGGGTTGGGGGATCCCGCCTGG + Intergenic
1132422208 15:101680086-101680108 CTGGGTTGGGGGAGGGGGATGGG + Intronic
1133008244 16:2896500-2896522 CTGGCTTGGGGGATGGCTCCTGG - Exonic
1133013807 16:2929736-2929758 CTGGCTTGGGGGATGGCTCCTGG - Exonic
1133297630 16:4762619-4762641 CTGGGCTGGGGGCTGCTGGCTGG + Exonic
1134303954 16:13015473-13015495 CTGGCTTTGGAGATGCCGACTGG - Intronic
1134334917 16:13289385-13289407 CAGGGTTGGGGGGTGCTGATGGG + Intergenic
1136499455 16:30662757-30662779 CTGGGGTGGGGGTGGCAGACTGG - Exonic
1136534639 16:30892663-30892685 CTGGGCTGGGGGGTGCCCCCAGG + Exonic
1138562489 16:57810209-57810231 CTGGGTGGGGAGATGGGGACAGG + Intronic
1138599095 16:58044722-58044744 CTGGGTTGGGGGCTGCAGTCAGG - Intronic
1140200619 16:72891781-72891803 CTGGGCTGGGGGTTGGGGACAGG - Intronic
1141066386 16:80917207-80917229 CAGGTTTGGGGGATTCGGACAGG + Intergenic
1143082123 17:4389395-4389417 CTGGGCTGGTGGATCCTGACGGG - Intergenic
1143575723 17:7792115-7792137 CTGAGATGGGGGATGCCCAGGGG - Intronic
1144966389 17:19079206-19079228 CTGGGCTGGGGGATGGTGCCTGG + Intergenic
1144981529 17:19172851-19172873 CTGGGCTGGGGGATGGTGCCTGG - Intergenic
1144986695 17:19205388-19205410 CTGGGCTGGGGGATGGTGCCTGG + Intergenic
1147669024 17:42166087-42166109 ATGGGTTGAGGGATGCCCAAGGG + Intronic
1148456176 17:47812725-47812747 CCTGGTTGGCGGAGGCCGACAGG - Intronic
1148782716 17:50130500-50130522 CTGGGCTGGGGGATTCCCAGAGG + Intergenic
1148851262 17:50556566-50556588 TTGGGTTGAGGGATGGGGACTGG + Intergenic
1149542308 17:57476879-57476901 ATGGGTTGGGGCATGGGGACTGG - Intronic
1149552769 17:57552369-57552391 CTGGGTTGGGGGGTGCTGGCTGG - Intronic
1150294313 17:63999524-63999546 TAGGGTTGGGGGATGGGGACAGG + Intronic
1150656615 17:67043969-67043991 ATGGTTTGGGGGATGCCGTGGGG + Intergenic
1151854246 17:76710327-76710349 CTGGGCTGGGAGAGGCCGAGGGG + Intronic
1152531151 17:80920002-80920024 CTGGGTTTGGAGATGCAAACTGG - Intronic
1159443284 18:68508773-68508795 CTGGTTTGGGGGATACAGAACGG + Intergenic
1162175170 19:8824866-8824888 CTGGGATGGGGGATACAGACGGG - Intronic
1162726882 19:12695195-12695217 TTGGGTTGGGGGATGGCGCCTGG - Intronic
1162968513 19:14166879-14166901 CCAGGGTGGGGGATACCGACCGG + Intronic
1163215307 19:15871895-15871917 CTGGTTTGGGGGATGGTGCCAGG - Intergenic
1164542227 19:29129552-29129574 ATGCGTTGGGGGATGGCCACAGG + Intergenic
1165796811 19:38524429-38524451 CTGGGGTGGGGGCTGCTGGCTGG - Intronic
1166044255 19:40220379-40220401 CTGGGTTTGGAGATGCAGAGAGG - Intergenic
1166204066 19:41257637-41257659 CTGGGTTGGGGGAGACCTAAGGG - Intronic
1166299576 19:41906380-41906402 CTGGGATGGGGGATTCCAAAGGG - Intronic
1166712420 19:44945806-44945828 CTGGGTTGGGGGCTGTGGAGGGG - Intronic
1167502722 19:49856783-49856805 CAGGGTCGGGGGATGCCGATGGG + Intronic
1167663221 19:50808574-50808596 ATGGGTTCAGGGATGCAGACAGG - Intergenic
927108563 2:19848103-19848125 CTGGGTTGGGGAAGGCAGCCTGG - Intergenic
927812322 2:26187050-26187072 CTGGGCTGGGGGATGCTGGAAGG + Intronic
928061244 2:28115692-28115714 TGGGGTTGGGGGATGTAGACCGG + Intronic
930088978 2:47518234-47518256 CTGGATTGGGGGATGGGGACAGG + Exonic
931447236 2:62336758-62336780 GTGGGTTGGGGGATGGAGCCCGG - Intergenic
934944122 2:98524449-98524471 CTGGGTTGGGGGAGGAGGCCAGG + Intronic
934945785 2:98540405-98540427 CTGGGTTGAGAGATGCAGAAGGG - Intronic
938093285 2:128447062-128447084 CTGGGGTCGGGGAGGCCGCCTGG + Intergenic
940168721 2:150803694-150803716 CTGGGTTGGGGGGTGTCGCTGGG - Intergenic
941384901 2:164841247-164841269 CTGGGGTGGGAGAGGCCGGCGGG + Exonic
946504537 2:220284845-220284867 TTGGGGTGGGGGAAGCCCACAGG - Intergenic
948493640 2:238330740-238330762 GTGGGATGGGGGGTGCCTACTGG + Intronic
948751348 2:240135203-240135225 CTGGGTTGGGGGATGCCGACTGG - Intronic
1169065467 20:2692577-2692599 CTGGGCTGGGGGCTGCGGCCTGG - Intergenic
1169988055 20:11469214-11469236 CTGGGTTGTGGAATGCCCAGGGG + Intergenic
1171298082 20:24036234-24036256 CTGGGTTGGGGCATGTTGATAGG + Intergenic
1171346636 20:24470337-24470359 TTGGGATGGGGAATCCCGACGGG + Intronic
1173492673 20:43495814-43495836 CTGGATTGAGGGATGCCAGCTGG - Intergenic
1175133937 20:56809041-56809063 GTGGGTTGGGGGATGCTGGGCGG - Intergenic
1176179733 20:63743603-63743625 CTGGGGTGGCGGCGGCCGACGGG - Intergenic
1178510571 21:33201828-33201850 CTGGGTTGGGGGATAGGGGCAGG + Intergenic
1178544038 21:33479016-33479038 CTGGGTCGGGGGGTGCGGAGGGG - Intronic
1178875998 21:36414260-36414282 CTGGGAAGGGGGATGCAGAGGGG + Intronic
1181005808 22:20012913-20012935 CTGGGATGGAGGATGCAGCCTGG + Intronic
1182876385 22:33694968-33694990 CTGGGATTGGGGATGCAGCCTGG - Intronic
1183123473 22:35751398-35751420 GAGGGTTGGGGGATGGCGGCAGG + Intronic
1184081119 22:42220952-42220974 CAGGGTTTGGGGAAGCCAACAGG - Intronic
1184251038 22:43260498-43260520 CTGGGTTGGGGGCTGAGGCCTGG - Intronic
1184376426 22:44116736-44116758 CTGTGATGGGGGATGCTGCCTGG + Intronic
1184594039 22:45503382-45503404 CTGGGCTGGGGGACGCTGGCTGG + Intronic
1184967787 22:47994081-47994103 CTGGGTTGGAGGAGGCCGAGTGG - Intergenic
1185296337 22:50057105-50057127 CTGGGTTGGGGGATGAGGTCTGG + Intergenic
1185296411 22:50057364-50057386 CTGGGTTGGGGGATCAGGTCTGG + Intergenic
1185296445 22:50057454-50057476 CTGGGTTGGGGGATCAGGTCTGG + Intergenic
1185370507 22:50458830-50458852 CTGGATTGGGGGATGCAGGGAGG + Intronic
949261591 3:2107883-2107905 CTGGGTAGGGGTATGCCAAATGG - Intronic
949875912 3:8626049-8626071 TGGGGTTGTGGGATGCTGACTGG - Intronic
950152894 3:10702088-10702110 CTGGGTAGCGGGAAGCCCACTGG - Intronic
950567287 3:13777767-13777789 CAGGTATGTGGGATGCCGACTGG + Intergenic
953333484 3:42073865-42073887 TTGGGTTGGGGGCAGCTGACAGG - Intronic
953879955 3:46686425-46686447 CCGGGTTGGGTGATGCTGAAGGG + Exonic
955001061 3:54928407-54928429 TTGGGTTGGGGGATGCTGGACGG + Intronic
955046919 3:55369524-55369546 CTGGGCCTGGGGATGCCCACTGG + Intergenic
958533601 3:95366574-95366596 CTCTGTTGGGGGATGACGATAGG - Intergenic
960613950 3:119580134-119580156 CTGGGATGGGGGAAGAAGACCGG - Exonic
960944695 3:122958130-122958152 CTGGGCTGGGGGAAGCTGCCAGG - Intronic
961333966 3:126159103-126159125 CTGGGCTGGGGGAGGCTCACAGG - Intronic
977219942 4:94327046-94327068 CTGGGGAGGGGGATGCCAAGTGG + Intronic
983349020 4:166563013-166563035 CAGGGTCGGGGGAGGCCAACTGG + Intergenic
985549309 5:524989-525011 CTGGGGTGGGGGATGCTGGCTGG - Intergenic
985728890 5:1533729-1533751 CTGGGTTGGGGGATGTAAAATGG - Intergenic
990543517 5:56798843-56798865 TTGGGTTGGGGGCTGCAGAATGG - Intergenic
1002575378 5:180171106-180171128 CTGGGCTGGGGGAAGGCCACAGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1010376130 6:75172998-75173020 CAGGGTTGGGGGCTGCAGATTGG - Intronic
1015407583 6:132855103-132855125 CTGGGTTGGGGGATGGCTGTGGG + Intergenic
1015480416 6:133702281-133702303 CTGGGTTGGGGGAGGCAGAGAGG - Intergenic
1015830240 6:137361050-137361072 CTGGATTGGGGGATGCTGATAGG - Intergenic
1019305378 7:332162-332184 CAGGGTTGGGGGCTGCCCTCCGG + Intergenic
1019528711 7:1493200-1493222 GTGGGGTGGGGGATGCCGCAGGG + Intronic
1019734918 7:2645858-2645880 CTGGGGTGGGGGATCCTGCCAGG + Intronic
1019735881 7:2649529-2649551 CTGGCCTGGGGGCTGCTGACTGG + Intronic
1024636897 7:51298512-51298534 CTGGGGTGGGGGATGCCCTGTGG - Intronic
1025693913 7:63765302-63765324 CTGGGTCTGGAGAGGCCGACTGG - Intergenic
1026824823 7:73574963-73574985 CTGGGTTGGGTGATGCTGCTGGG + Intronic
1027446514 7:78279924-78279946 CTGGGTTTGAGGATGCCTGCAGG - Intronic
1028075899 7:86514868-86514890 CTGGGTTGGGGGCTGCTGCATGG + Intergenic
1029431679 7:100535212-100535234 CTGGGTTAGGGGGTGCTGATAGG - Intergenic
1029570174 7:101363544-101363566 GGGGGTTGGGGGCTGCAGACGGG + Intronic
1032021530 7:128409569-128409591 TTTGGTTGGGGGATGCAGACGGG - Intronic
1032384640 7:131513168-131513190 CTGCTTTGGGGAATGCAGACTGG + Intronic
1036206789 8:6811503-6811525 CTGGGTGGGGCGATGCAGGCTGG + Exonic
1037707735 8:21329840-21329862 CTGGGCTGTGGGATGGAGACTGG - Intergenic
1037817897 8:22121339-22121361 CTGAGGTGGGGGATGCTGGCTGG - Intronic
1041246547 8:55894157-55894179 GGGGGTTGGGGGATGCAGACAGG - Intronic
1043871421 8:85438136-85438158 CTAGGTTGGGAAATGCCGCCTGG + Intronic
1048465098 8:134659029-134659051 CTGGTGAGGGGGATGCCGAAGGG - Intronic
1049667977 8:143856559-143856581 CTAGGATGGGGGATGCGGTCAGG - Intergenic
1051721195 9:20039338-20039360 CTGGAATTGGGGATGCCAACTGG + Intergenic
1053351633 9:37417187-37417209 ATGGGCTGGGGGATGCGGTCAGG + Intergenic
1053415418 9:37944262-37944284 TTGGGGGGTGGGATGCCGACAGG + Intronic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1056452959 9:86734389-86734411 CTGGGTTGAGGGACGCCTAGAGG - Intergenic
1057334387 9:94144326-94144348 CTGGGCTGGGGGCTGCCTGCAGG - Intergenic
1059350727 9:113662934-113662956 CTGGGTTGGGGAATGGGGAGTGG + Intergenic
1060482216 9:124023176-124023198 CTGGGTTGGGGAAGGACGAAGGG - Intronic
1061081648 9:128374427-128374449 CTGGGGTGGGGGAGGGTGACAGG - Intronic
1061497512 9:130983397-130983419 CTGGGTGGGGGGCTTCAGACTGG + Intergenic
1062057439 9:134475796-134475818 CTGGGTTTGGGGCTGCAGCCAGG + Intergenic
1062250195 9:135589995-135590017 CAAGGTTGGGGGAGGCCGCCAGG - Intergenic
1062642220 9:137525042-137525064 CTGGGTTGGGCCTTGCCGCCAGG - Intronic
1203773293 EBV:60037-60059 CTGGGTGCGGGGATGAAGACAGG + Intergenic
1188779884 X:34268836-34268858 CAGGGTTGGGGCATGGGGACTGG - Intergenic
1200043119 X:153384267-153384289 ATGGGTTGGGGGCTGCTGAGGGG - Intergenic
1200102370 X:153694465-153694487 CTGGGCTGGGGGATGGTGGCGGG + Intronic
1200211532 X:154348812-154348834 CAGGCTTGGGGGCTGCCGGCTGG + Exonic
1202380941 Y:24276332-24276354 CTGGGCTGGGAGATGCAGCCAGG + Intergenic
1202489844 Y:25393794-25393816 CTGGGCTGGGAGATGCAGCCAGG - Intergenic