ID: 948751554

View in Genome Browser
Species Human (GRCh38)
Location 2:240136187-240136209
Sequence CGGCGGGAGTCTCCGAGCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948751554_948751568 15 Left 948751554 2:240136187-240136209 CCCACGCTCGGAGACTCCCGCCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 948751568 2:240136225-240136247 GTCCAGGTCCACGTAGGGCCCGG 0: 2
1: 0
2: 0
3: 9
4: 113
948751554_948751561 -1 Left 948751554 2:240136187-240136209 CCCACGCTCGGAGACTCCCGCCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 948751561 2:240136209-240136231 GGGCCCGTGCCACCTCGTCCAGG 0: 1
1: 0
2: 0
3: 23
4: 242
948751554_948751572 25 Left 948751554 2:240136187-240136209 CCCACGCTCGGAGACTCCCGCCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 948751572 2:240136235-240136257 ACGTAGGGCCCGGCGCCCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 53
948751554_948751573 26 Left 948751554 2:240136187-240136209 CCCACGCTCGGAGACTCCCGCCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 948751573 2:240136236-240136258 CGTAGGGCCCGGCGCCCTCGGGG 0: 1
1: 0
2: 1
3: 8
4: 59
948751554_948751566 10 Left 948751554 2:240136187-240136209 CCCACGCTCGGAGACTCCCGCCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 948751566 2:240136220-240136242 ACCTCGTCCAGGTCCACGTAGGG 0: 1
1: 1
2: 1
3: 3
4: 33
948751554_948751571 24 Left 948751554 2:240136187-240136209 CCCACGCTCGGAGACTCCCGCCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 948751571 2:240136234-240136256 CACGTAGGGCCCGGCGCCCTCGG 0: 2
1: 0
2: 0
3: 6
4: 70
948751554_948751565 9 Left 948751554 2:240136187-240136209 CCCACGCTCGGAGACTCCCGCCG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 948751565 2:240136219-240136241 CACCTCGTCCAGGTCCACGTAGG 0: 1
1: 1
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948751554 Original CRISPR CGGCGGGAGTCTCCGAGCGT GGG (reversed) Exonic
901443561 1:9293360-9293382 CGGCGGGGGTCTCGGGGCGCGGG + Intronic
904837682 1:33349700-33349722 CGCCGGGAGCCTCCGAGCCGGGG + Intronic
1065993023 10:31031576-31031598 CGGGGCGCGTCTCCGAGCCTGGG - Intronic
1067071914 10:43138591-43138613 CGGCGGGAGTCGCGGACCGGCGG - Intronic
1077371177 11:2182317-2182339 GGGCAGGAGTCTCCCAGCGCAGG + Intergenic
1083246164 11:61429802-61429824 CGGCCGGAGTCTGCGGGCGGAGG - Exonic
1097895884 12:64824686-64824708 CCGCGGGAGCCGCCGAGCGCAGG - Exonic
1105975506 13:25468903-25468925 AGGCGGGAGGCTGCGAGCGCGGG - Intronic
1115174613 14:30547796-30547818 CGGCCGGAGGCTCTGAGTGTGGG + Intergenic
1132915272 16:2340560-2340582 CGGCGGCACTCACCGAGCCTGGG + Exonic
1139429404 16:66903200-66903222 GGGCGGGAGTCTCCCAAAGTGGG + Intergenic
1140758147 16:78087502-78087524 CGGCGTGAGTCACCGTGCCTAGG + Intergenic
1147686216 17:42288304-42288326 CGGCGGGCGGCGCCGGGCGTGGG - Exonic
1151783735 17:76265263-76265285 CAGCGGCAGTCCCCGAACGTTGG + Exonic
1157252225 18:46104790-46104812 CGCCGGGAGGCTCCCAGTGTTGG - Intronic
1162235916 19:9309622-9309644 CGGCGGGAGGCCCCGGGCGCGGG + Intronic
928701555 2:33903790-33903812 CGGCCGGCCTCTCCGAGTGTGGG + Intergenic
934636206 2:95992074-95992096 GCGCGGGGGGCTCCGAGCGTCGG - Intergenic
934797443 2:97113352-97113374 GCGCGGGGGACTCCGAGCGTCGG + Intergenic
934835968 2:97590087-97590109 GCGCGGGGGGCTCCGAGCGTCGG - Intergenic
935590960 2:104845084-104845106 CGGCGGGCGCCTCTGAGCCTGGG - Intergenic
938716636 2:134027750-134027772 CGGTGGGCCTCTCCTAGCGTGGG + Intergenic
944495805 2:200306657-200306679 GGGCGGGAGTGTCCCTGCGTGGG + Intronic
948751554 2:240136187-240136209 CGGCGGGAGTCTCCGAGCGTGGG - Exonic
1184922664 22:47616455-47616477 CGGCCGGAGCCTCCAAGGGTGGG - Intergenic
949970257 3:9397714-9397736 CTGCGTGAGTCTCTGAGCGCAGG - Exonic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
983064102 4:163189983-163190005 CGGCGGGCTGCTCCGAGCGCGGG + Intergenic
984241847 4:177227805-177227827 CGGCGGGCCGCTCCGAGAGTGGG + Intergenic
1004241389 6:13925181-13925203 CGGAGGGAGACTCCGCGCGCGGG - Intronic
1019298017 7:289480-289502 CGGCGGGCGTCTCCCGGCCTTGG - Intergenic
1024610315 7:51058766-51058788 CAGCCGGAGCCTCTGAGCGTGGG + Intronic
1036656633 8:10681373-10681395 GGGCGGGAGTCTTCCAGCTTGGG + Intronic
1041085671 8:54254283-54254305 GGGAGGGAGGCTCCGAGCTTGGG + Intergenic
1044459666 8:92429508-92429530 CGGCCGGCCACTCCGAGCGTGGG + Intergenic
1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG + Intergenic
1050294893 9:4195380-4195402 CGGCTGGCCTCTCCGAGTGTGGG - Intronic
1054722428 9:68617106-68617128 CGGCGGGCTGCTCCGAGTGTGGG - Intergenic
1196389034 X:115190201-115190223 CGGCTGTAGTCTCTGAGCGCAGG - Exonic