ID: 948753003

View in Genome Browser
Species Human (GRCh38)
Location 2:240143325-240143347
Sequence GGTTAGGGATGCAGAATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 1, 2: 10, 3: 105, 4: 519}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948753003_948753011 23 Left 948753003 2:240143325-240143347 CCTGGGATTCTGCATCCCTAACC 0: 1
1: 1
2: 10
3: 105
4: 519
Right 948753011 2:240143371-240143393 ACTGGTCCCCCAGCACACTTTGG 0: 1
1: 0
2: 0
3: 6
4: 117
948753003_948753012 24 Left 948753003 2:240143325-240143347 CCTGGGATTCTGCATCCCTAACC 0: 1
1: 1
2: 10
3: 105
4: 519
Right 948753012 2:240143372-240143394 CTGGTCCCCCAGCACACTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 188
948753003_948753006 -5 Left 948753003 2:240143325-240143347 CCTGGGATTCTGCATCCCTAACC 0: 1
1: 1
2: 10
3: 105
4: 519
Right 948753006 2:240143343-240143365 TAACCAGCTCCCAAGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 136
948753003_948753010 5 Left 948753003 2:240143325-240143347 CCTGGGATTCTGCATCCCTAACC 0: 1
1: 1
2: 10
3: 105
4: 519
Right 948753010 2:240143353-240143375 CCAAGAGCTCAGGATACTACTGG 0: 1
1: 0
2: 0
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948753003 Original CRISPR GGTTAGGGATGCAGAATCCC AGG (reversed) Intronic
901131423 1:6963989-6964011 AGATAGGGGTGCAGAATCCTGGG + Intronic
901173555 1:7282220-7282242 GGTTGGGCCTGCAGGATCCCTGG - Intronic
901682017 1:10918626-10918648 TGTCAGAAATGCAGAATCCCAGG - Intergenic
903000885 1:20264845-20264867 GATTAGAAATGCAGAATCTCAGG + Intergenic
905007224 1:34719526-34719548 TGTTAGACATGAAGAATCCCAGG + Intronic
905229540 1:36506309-36506331 GGTGGGGGCTGCAGAACCCCAGG - Intergenic
906223943 1:44105771-44105793 TGTTAGAAATGCAGAATCCCTGG - Intergenic
907374381 1:54023789-54023811 GGTTAGAGATGCAGATTCCCAGG + Intergenic
907814421 1:57904153-57904175 TGTTAGGAATGCAGAATCTCAGG - Intronic
907938589 1:59065360-59065382 TGTTAGAAATGCAGAATCTCAGG + Intergenic
908247101 1:62236266-62236288 GGTTAGAAATGCAGAATCTCAGG + Intergenic
908799921 1:67869031-67869053 TGTTAGAAATGCAGAATCTCAGG - Intergenic
908802066 1:67890700-67890722 GGATAGGGAGGCAGAATACCTGG - Intergenic
909368833 1:74860679-74860701 GGTCAGGGAGAAAGAATCCCAGG + Intergenic
909576695 1:77184360-77184382 GTTTACAGATCCAGAATCCCTGG + Intronic
910527181 1:88193634-88193656 GGATAGGAATGCAGAATGGCTGG + Intergenic
911263407 1:95714569-95714591 TGTTAGAAATGCAGAATCTCAGG - Intergenic
911599156 1:99829510-99829532 TGTTAGAAATGCAGAATCTCAGG - Intergenic
913562212 1:120032720-120032742 TGTTAGGAATGCAGATTCCCAGG - Intronic
913635912 1:120760874-120760896 TGTTAGGAATGCAGATTCCCAGG + Intergenic
914282796 1:146192108-146192130 TGTTAGGAATGCAGATTCCCAGG - Intronic
914543826 1:148642824-148642846 TGTTAGGAATGCAGATTCCCAGG - Intronic
914622795 1:149428185-149428207 TGTTAGGAATGCAGATTCCCAGG + Intergenic
915263839 1:154700263-154700285 TGTTAGAAATGCAGAATCTCAGG - Exonic
916213419 1:162376088-162376110 TGTTAGAAATGCAGAATCTCAGG - Intronic
916520985 1:165563337-165563359 TGTTAGAAATGCAGAATCTCAGG - Intronic
916942635 1:169692069-169692091 TGTTAGGGGTGCAGAATCTCAGG - Intronic
917265406 1:173215953-173215975 TGTTAGAAAAGCAGAATCCCAGG + Intergenic
917296951 1:173530171-173530193 TGTTAGGAATGCAAAATCTCAGG + Intronic
917510822 1:175667985-175668007 TGTTAGAAATGCAGAATCTCAGG + Intronic
917599988 1:176564177-176564199 TGTTAGAAATGCAGAATCTCAGG - Intronic
917852727 1:179079212-179079234 TGTTAGAAATGCAGAATCTCAGG - Intergenic
918662828 1:187110310-187110332 GCTTAGGGATGCAGAATCTCAGG - Intergenic
920127481 1:203704934-203704956 TATTAGGAATGCAGAATCTCGGG - Intronic
920578130 1:207078334-207078356 CATTAGAAATGCAGAATCCCAGG + Intronic
920685076 1:208103099-208103121 GGTTTGGCATGCAGAAGACCGGG - Intronic
922614616 1:226954460-226954482 TGTTAGAGATGCAGATTCCCGGG + Intronic
922898205 1:229116847-229116869 GGATGGGGATACAGAATCCTGGG - Intergenic
923623985 1:235599232-235599254 CGTTAGCAATGCAGAATCTCAGG + Intronic
923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG + Intergenic
923987309 1:239395654-239395676 GGTTAGAAATGCAGATTCTCAGG - Intronic
924063044 1:240196421-240196443 GGTTAGATATGCAGATTCTCAGG + Intronic
1065639124 10:27763752-27763774 TGTTAGGAATGCAGAATCTCTGG - Intergenic
1066580615 10:36876807-36876829 TGCTAGGTATGCAGAATCTCAGG + Intergenic
1067007097 10:42674452-42674474 GGTCAGGGGTGGAGAAGCCCTGG + Intergenic
1067773345 10:49143448-49143470 TGTTAGAGATGCAAATTCCCAGG + Intergenic
1069271952 10:66539796-66539818 TGTTAGACATGCAGAATCTCAGG + Intronic
1069415344 10:68195670-68195692 GGTTGGAAATGCAGAATCCCAGG + Intronic
1069685899 10:70318293-70318315 GGTTAGAAATGCACATTCCCTGG - Intronic
1070754983 10:78986424-78986446 CGTTAGAAATGCAGAATCTCAGG - Intergenic
1070873030 10:79774788-79774810 TGTGAGAAATGCAGAATCCCAGG + Intergenic
1070988294 10:80707642-80707664 GGTGAGGGAGGCTGAGTCCCTGG + Intergenic
1071516765 10:86302846-86302868 TGTTAGAAATGCAGAATCTCAGG + Intronic
1071639956 10:87296939-87296961 TGTGAGAAATGCAGAATCCCAGG + Intergenic
1071655278 10:87441010-87441032 TGTGAGAAATGCAGAATCCCAGG - Intergenic
1072077107 10:91987884-91987906 GGTTAGGGATGGGGAATTCCTGG - Intronic
1072225904 10:93368408-93368430 TGTTAAGCATGCAGACTCCCAGG - Intronic
1072800515 10:98389375-98389397 GGTTACTGTTGCAGAATCCAAGG - Intronic
1073620567 10:105043294-105043316 TGTTAGAAATGCAGAATCTCAGG + Intronic
1074744966 10:116523403-116523425 GGTGTGGGCTGCAGAATCCCTGG + Intergenic
1074904801 10:117852243-117852265 GCTTAGAAATGCAGAATCTCAGG - Intergenic
1075994957 10:126869774-126869796 GGTTTGGGATGCAGAAGCAGAGG + Intergenic
1077459598 11:2702148-2702170 GGTCAGGGGAGCAGGATCCCAGG + Intronic
1079355443 11:19726742-19726764 TGTTAGAAATGCAGAATCCCAGG + Intronic
1079705286 11:23608369-23608391 TGTCAGGGATTCAGAATTCCAGG - Intergenic
1080160606 11:29170761-29170783 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1080249150 11:30213629-30213651 TGTTAGACATGCAGAATCCCGGG + Intergenic
1080556431 11:33421451-33421473 TGTTAGAAATGCAGAATCCTAGG + Intergenic
1080603098 11:33840034-33840056 TGTTAGGAATGCAGAATTTCAGG - Intergenic
1080613378 11:33924902-33924924 GGTCAGGGCTGCTGGATCCCAGG + Intergenic
1080851191 11:36071811-36071833 TGTTAGGAATGCAGGATCCCAGG + Intronic
1081268838 11:41059735-41059757 TGTTAGAAATGCAGAATCTCTGG + Intronic
1081333568 11:41834884-41834906 GGTTAGAAATGCAGAATCTCAGG + Intergenic
1081523990 11:43911308-43911330 GGGTAAGGATCCAGACTCCCAGG + Intronic
1081655294 11:44853271-44853293 GGTTAGGGACGTAGAGTCCATGG + Intronic
1082064469 11:47888246-47888268 TGTTAGGAATGCATAATCTCGGG + Intergenic
1084069680 11:66726392-66726414 GGTTAGAAATGCACATTCCCAGG - Intronic
1084696999 11:70761702-70761724 TGTTAGGAATGCAGGCTCCCAGG - Intronic
1085442602 11:76578073-76578095 GGTTAGAAATGCAGACTCTCAGG - Intergenic
1085514021 11:77102058-77102080 GGTTAGGAATGCAGATTCTCAGG + Intronic
1085907248 11:80778463-80778485 TGTTAGTGATGCAGAATCTCAGG - Intergenic
1085967425 11:81544950-81544972 GGTTAAGGATCCAGAAGTCCTGG + Intergenic
1086806423 11:91248933-91248955 AGTTAGGGATGTGGAATCACAGG - Intergenic
1087077091 11:94135185-94135207 GGTGAGGGAGGCAGGGTCCCCGG - Intronic
1087767672 11:102174047-102174069 TGTTAGAAATGCAGAATCTCAGG - Intronic
1087817851 11:102678808-102678830 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1088398641 11:109398178-109398200 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1088585281 11:111355642-111355664 GATTAGACATGCAAAATCCCAGG - Intronic
1088597976 11:111454047-111454069 TGTTAGAAATGCAGAATCTCAGG - Intronic
1088606955 11:111541362-111541384 GGGTAGGGATGCTGGATCCCCGG + Intronic
1088687567 11:112297944-112297966 GATTAGAAATGCAGAATCTCAGG - Intergenic
1089033833 11:115363438-115363460 GGTTAAGGATTCAGAAACTCTGG + Intronic
1089195414 11:116691688-116691710 AGTTAGGGATGAAAAATCTCTGG - Intergenic
1089713187 11:120332128-120332150 GGTTAAGAATCCAGAATTCCTGG + Intronic
1090055558 11:123420761-123420783 GGTTTGGGATTCAGAATACCTGG + Intergenic
1091628369 12:2139875-2139897 GCTTAGGGATCCAGAAGCCAGGG - Intronic
1091828456 12:3532833-3532855 GGTAAGAAATGCAGATTCCCAGG - Intronic
1092813233 12:12290799-12290821 TGTTAGACATGCAGATTCCCAGG - Intergenic
1093204726 12:16233771-16233793 TGTTAGACATGCAGAATCTCAGG + Intronic
1093381475 12:18499858-18499880 TGTTAGAAATGCAGAATCTCAGG + Intronic
1094017786 12:25883437-25883459 GGTTAGGCATTCTGAATCACAGG + Intergenic
1095382470 12:41612204-41612226 TATTAGAGATGCAGAATCTCTGG + Intergenic
1095516534 12:43012406-43012428 TGTTGGAAATGCAGAATCCCAGG - Intergenic
1095543400 12:43338040-43338062 GGTTTGAAATGCAGAACCCCAGG + Intergenic
1097691432 12:62738210-62738232 TGTTAGAAATGCAGAATCTCAGG + Intronic
1097885412 12:64724098-64724120 GCTTGGAGATGCAGAATCTCAGG + Intronic
1098095857 12:66955273-66955295 GGTTAGAGATGCAAATTCTCAGG - Intergenic
1098365559 12:69699902-69699924 GGTTAAGGCTGGAGAATCACTGG + Intergenic
1098601147 12:72332824-72332846 TGTTAGAAATGCAGAATCTCTGG + Intronic
1098601529 12:72336971-72336993 TGTTAGAAATGCAGAATCTCAGG + Intronic
1101801641 12:108027613-108027635 GGTTAGGGGTGCAGTTTGCCTGG + Intergenic
1101832639 12:108271332-108271354 GGTTAGAAGTGCAGAATCTCAGG + Intergenic
1102079311 12:110085215-110085237 GTTTAGGGTTGCAGAAGACCTGG - Intergenic
1102471706 12:113163160-113163182 GGTAGGGGATGTAGAATTCCTGG + Exonic
1102556295 12:113728929-113728951 TGTTAGGAATGCAGAGTCCCGGG - Intergenic
1102623421 12:114215172-114215194 GCTTAGAAATGCAGAATCTCAGG + Intergenic
1102634719 12:114312811-114312833 GGTTAGAGATGCTGAATCCCAGG - Intergenic
1102806073 12:115782161-115782183 TGTTAGAGATGCAGAACCTCAGG - Intergenic
1103112986 12:118298321-118298343 TGTTAGGAATGCAGGATCTCTGG - Intronic
1103201855 12:119094342-119094364 GGTTAGAAATGCAGAAACTCAGG + Intronic
1103922526 12:124406375-124406397 GGTTAGAAATGCAGAGTCCCAGG - Intronic
1104420417 12:128630189-128630211 TGTTAGGGATGCAGATTCCTGGG - Intronic
1104738479 12:131154656-131154678 TGTAAGAAATGCAGAATCCCAGG - Intergenic
1104946055 12:132415332-132415354 CGTCAGGAATGCAGACTCCCTGG - Intergenic
1105594250 13:21821291-21821313 TCTTAGAAATGCAGAATCCCAGG + Intergenic
1106586176 13:31058261-31058283 GGTAAGGGATCAAGAATTCCTGG + Intergenic
1106633693 13:31504682-31504704 TGATAGAAATGCAGAATCCCGGG - Intergenic
1107523118 13:41203052-41203074 TGTTAGAAATGCAGAATCACAGG + Intergenic
1107978324 13:45711622-45711644 GGTTAGAAATGCAGATTCCTGGG + Intronic
1108001524 13:45909538-45909560 GGTGAGGGTGGCAGGATCCCTGG + Intergenic
1108510558 13:51151967-51151989 TGTTAGAAATGCAGAATCTCTGG + Intergenic
1108520037 13:51238296-51238318 TGTTAGAAATGCAGAATCCCAGG + Intronic
1108843099 13:54645401-54645423 GGTTAGTGATGTAGAAACCATGG - Intergenic
1111868269 13:93797204-93797226 TGTTAGAAATGCAGAATCTCAGG - Intronic
1112212966 13:97399569-97399591 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1112576357 13:100640060-100640082 GGTTAGGAATTCAGGATCCCAGG - Intronic
1112678549 13:101734109-101734131 TGTTAGAAATGCAGAATCCCAGG + Intronic
1113440514 13:110324621-110324643 CATTAGGAATGCAGAGTCCCAGG - Intronic
1113522543 13:110950993-110951015 GGGTTGGGATGCAGATTCCTGGG + Intergenic
1113702890 13:112400199-112400221 GGATTGGGATGCAGATTCCTGGG - Intronic
1114211627 14:20620616-20620638 GATTAGAAATGCAGAATCTCAGG - Intergenic
1115047679 14:29016578-29016600 TGTTAGCGGTGCAGAATCTCAGG + Intergenic
1115050749 14:29059773-29059795 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1115270871 14:31550808-31550830 GGTCAGAGTTGCAGACTCCCTGG + Intronic
1115518852 14:34212810-34212832 GGTTAGTGATTCATAAACCCTGG + Intronic
1115877300 14:37874990-37875012 TGTTAGGAATGCAGAACCCTAGG + Intronic
1117045774 14:51811668-51811690 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1117419782 14:55532948-55532970 GGTTTGGGAGACAGGATCCCTGG + Intergenic
1117882591 14:60327004-60327026 CGTTAGGAATGCAGAATCTCAGG - Intergenic
1118200983 14:63673012-63673034 TGTTAGGAATGCAGACTCCTGGG - Intergenic
1118463659 14:66011658-66011680 TGTTAGAAATGCAGAATCCCAGG + Intergenic
1118520461 14:66577133-66577155 AGTTAGAAATGCAGAATCTCAGG - Intronic
1118945500 14:70382531-70382553 TGTTAGAAATGCAGAATCTCAGG - Intronic
1119120130 14:72067889-72067911 GGCTAGACATGCAGAATCACAGG + Intronic
1119124719 14:72115195-72115217 GATTAGAGAAGCAGAATCACAGG + Intronic
1119678432 14:76573760-76573782 TGTTAGAAATGCAGAATCTCGGG - Intergenic
1119953736 14:78772697-78772719 TGCTAGAAATGCAGAATCCCAGG - Intronic
1120222079 14:81745848-81745870 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1120492223 14:85192170-85192192 GGTTCTGGATGCAGACTGCCTGG + Intergenic
1120523987 14:85556561-85556583 GGTTGTGGAGGCAGACTCCCTGG + Intronic
1121149522 14:91618895-91618917 TGTTAGAAATGCAGAATCTCAGG - Intronic
1121679997 14:95785903-95785925 TGTTAGGCAAGCAGAATCTCAGG - Intergenic
1121756652 14:96408376-96408398 GGTTACAGATGCAGAAACCGAGG - Intronic
1121967323 14:98322531-98322553 GGTGAGGGGTTCAGAAACCCAGG + Intergenic
1123457019 15:20435544-20435566 TGTTAGAAATGCAGACTCCCAGG - Intergenic
1123661043 15:22564815-22564837 TGTTAGAAATGCAGACTCCCAGG + Intergenic
1124263173 15:28210697-28210719 TGTTAGAAATGCAGACTCCCAGG - Intronic
1124314843 15:28659049-28659071 TGTTAGAAATGCAGACTCCCAGG + Intergenic
1124785293 15:32673458-32673480 TGTGAGGAATGCAGAATCTCAGG + Intronic
1124870746 15:33539605-33539627 GGTTAGGGATGCTGACCCCCTGG + Intronic
1126182657 15:45801013-45801035 TGTCAGAAATGCAGAATCCCAGG - Intergenic
1126612210 15:50541028-50541050 GGGTAGGAATGCAGTATTCCTGG - Exonic
1126904963 15:53354894-53354916 GGTTAGGAAATCAGAGTCCCAGG - Intergenic
1126911126 15:53418159-53418181 GCCCAGAGATGCAGAATCCCTGG - Intergenic
1127337999 15:58009277-58009299 GGTTAGACATGCAGAGTCTCAGG + Intronic
1127413104 15:58729429-58729451 TGTTAGCAATGCAGAATCCTAGG + Intronic
1127759863 15:62128169-62128191 GGTGAGGGATTCAGAATCTTAGG + Intergenic
1128271567 15:66314862-66314884 GGTTAGGAATGAAGAATTGCTGG - Intronic
1128556369 15:68634637-68634659 TGTTAGGGATGCAGATTCTCGGG + Intronic
1128556402 15:68634858-68634880 GGTTAGAAATGGAGAATCCCAGG - Intronic
1129332991 15:74837292-74837314 GGTAAGGGAGGCAGAACCCAGGG + Intronic
1129782742 15:78284568-78284590 TGTTAGAAATGCAGAATCCCAGG + Intronic
1129894967 15:79096963-79096985 TGTTAGGGAAGCAGAAGCCTAGG + Intergenic
1130737776 15:86568678-86568700 TGTTAGAAATGCAGACTCCCAGG + Intronic
1131306519 15:91248724-91248746 TGTTAGAGATGCAGAATCTCAGG + Intronic
1133406979 16:5532404-5532426 TCTTAGAGATGCAGAATCTCAGG + Intergenic
1133442860 16:5835571-5835593 TGTTAGGAATGCAGATTCCTGGG - Intergenic
1133966001 16:10532139-10532161 CGTTAGAAATGCAGATTCCCTGG + Exonic
1134669992 16:16047763-16047785 GCGTAGAAATGCAGAATCCCAGG + Intronic
1134829416 16:17311245-17311267 GGTTAGAAATGCAGACTCCCAGG + Intronic
1134882584 16:17758679-17758701 GGTGGGAAATGCAGAATCCCAGG - Intergenic
1135044885 16:19147019-19147041 TGTTAGAAATGCAGAATCTCAGG - Intronic
1135046311 16:19158878-19158900 TGTCAGAAATGCAGAATCCCAGG - Intronic
1135055976 16:19232402-19232424 TGTTAGAAATGCAGAATTCCAGG - Intronic
1135072582 16:19364974-19364996 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1136070481 16:27784361-27784383 GGCAAGGGAGGAAGAATCCCAGG - Intergenic
1136411950 16:30082856-30082878 GGTTGGGGGTGCAGAAGCCGGGG - Intronic
1137595459 16:49720613-49720635 TTTTAGGGAAGCAGAATCCTTGG - Intronic
1137604645 16:49779444-49779466 TGTTAGAAATGCAGAATCTCAGG + Intronic
1138420979 16:56898905-56898927 TGTTAGAAATGCAGAATCCCAGG + Intronic
1138449707 16:57086339-57086361 TCTTAGAAATGCAGAATCCCAGG - Intergenic
1140035085 16:71365630-71365652 TGTTAGGAATGCAGAATCCCAGG - Intronic
1140467742 16:75195968-75195990 TGTTAGCAATGCAGATTCCCAGG - Intergenic
1140714530 16:77710152-77710174 TGGTAGGCATGCAGAGTCCCAGG - Intergenic
1140951294 16:79820370-79820392 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1141174870 16:81712248-81712270 CGTCAGGAATGCAGATTCCCAGG - Intergenic
1141207413 16:81943597-81943619 CATTAGAGATGCAGAATCTCAGG + Intronic
1141278011 16:82605647-82605669 TGTTAGGAATTCAGAATCTCAGG + Intergenic
1141459983 16:84172513-84172535 GGTTAGAAATGCAGACTCCCAGG + Intronic
1141752508 16:85968295-85968317 GGCTGGAAATGCAGAATCCCGGG - Intergenic
1141875249 16:86819773-86819795 GGTTAAAAATGCAGAACCCCAGG - Intergenic
1141888237 16:86908029-86908051 TGTTAGAGATGCAGGATCTCAGG - Intergenic
1142244065 16:88960874-88960896 GATTACAGATGCAGAATGCCTGG + Intronic
1142679549 17:1538447-1538469 GGTGAGGGATGCAGAATGCAGGG - Intronic
1142952850 17:3497819-3497841 TGTTAGACATGCAGAATCCCAGG + Intronic
1143417952 17:6763732-6763754 TGTTAGAAATGCAGAATCTCAGG + Intronic
1143649531 17:8254986-8255008 GGTTAGGACTGGAGAACCCCCGG - Intronic
1143673144 17:8410779-8410801 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1143803891 17:9409105-9409127 GGTTAGACATGCAGAATCTCAGG + Intronic
1144016060 17:11197480-11197502 GGTCAGGGATGCAAAACCACAGG - Intergenic
1144099667 17:11932491-11932513 AGTTAGAAATGCAGAATCTCAGG + Intronic
1144388461 17:14771541-14771563 TGTTAGAAATGCAGAATCCTTGG - Intergenic
1144479607 17:15618027-15618049 TGTTAGAAATACAGAATCCCTGG + Intronic
1144918696 17:18745712-18745734 TGTTAGAAATACAGAATCCCTGG - Intronic
1146267933 17:31465336-31465358 TGCTAAGGATGCAGATTCCCAGG - Intronic
1146297366 17:31660337-31660359 TGTTAGAAATGCAGAGTCCCAGG + Intergenic
1146575255 17:33985414-33985436 TGTTAGAGATGCAGAATGTCAGG - Intronic
1146605026 17:34250755-34250777 GGTTAGCAATGCAGAACCGCAGG + Intergenic
1146655739 17:34633811-34633833 GGTGAGAAATGCAGAATCACAGG - Intronic
1146723297 17:35138346-35138368 TGTTAGAAATGCAGATTCCCAGG + Intronic
1147547684 17:41415340-41415362 TGTTAGAAATGCAGACTCCCTGG - Intergenic
1147842658 17:43382934-43382956 GGTTAGAAGTGCAGAATCACTGG + Intergenic
1148976646 17:51535745-51535767 TGTTAGGAATGCAGACTCTCAGG + Intergenic
1149057862 17:52387284-52387306 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1149560142 17:57602836-57602858 GGTTAGGAATGCAGAGTCCCAGG + Intronic
1149606702 17:57930183-57930205 GGTTAGAAATGGAGAATCACGGG - Intronic
1150095496 17:62371146-62371168 TGTTAGGAAGGCAGAATCTCAGG - Intronic
1150336261 17:64332802-64332824 TCTTAGGGAGGCAGAAACCCTGG - Intronic
1151283086 17:73091016-73091038 AGTTAGGAATGCAGAAACTCAGG + Intronic
1151324282 17:73369313-73369335 GGTGAGGGATGCAGAGTCTCAGG + Intronic
1151541632 17:74767694-74767716 GGTTAGGGTTTCAGGATTCCTGG + Intronic
1151854992 17:76714606-76714628 GAATAGGGCTGCTGAATCCCTGG + Exonic
1153320865 18:3772763-3772785 TGTTAGGCATGCAGAATCACAGG + Intronic
1153622214 18:6989859-6989881 TGTTAAGGATGGAGAGTCCCAGG + Intronic
1154110697 18:11566172-11566194 GGTTAGGGCTTCAGCATCTCTGG - Intergenic
1155106608 18:22673132-22673154 GGCTAGGGATACTGACTCCCTGG - Intergenic
1155865940 18:30964837-30964859 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1155990136 18:32271572-32271594 TGTTAGAAATGCAGATTCCCAGG - Intronic
1156330643 18:36118510-36118532 GGTTGGGGAGGCAGCATTCCAGG + Intronic
1156556703 18:38076541-38076563 GGTGAGGGAGGCAGGATCGCAGG - Intergenic
1157026294 18:43847988-43848010 GGTTAGGGATGAGTAATCTCCGG - Intergenic
1157167624 18:45372651-45372673 TGTTGGGAATGCAGAATCTCAGG - Intronic
1157201425 18:45663183-45663205 TGTTAGAAATGCAGAATCTCAGG - Intronic
1157704965 18:49798391-49798413 GGTTAGAAATGCAGAATCTCCGG - Intronic
1157710423 18:49846308-49846330 GGTGAGAGATGCAGAGTCTCGGG - Intronic
1157920817 18:51711079-51711101 GGTTAGAAATGCAAAGTCCCTGG - Intergenic
1158875984 18:61735049-61735071 GGTCAGGGAGGGAGGATCCCTGG + Intergenic
1158978557 18:62736233-62736255 TGTTAGAAATGCAGAATCTCAGG + Intronic
1160905074 19:1448096-1448118 GGTTGGGGATGCAGAGCCCAGGG - Intronic
1161436916 19:4268942-4268964 GCTTAGGGCTGCAACATCCCTGG + Exonic
1161492213 19:4568192-4568214 TGTCAGAAATGCAGAATCCCAGG + Intergenic
1161874274 19:6895557-6895579 TGTTAGAAATGCAAAATCCCCGG + Intronic
1164155385 19:22593116-22593138 TGTAAGGAATGCAGAATCTCAGG + Intergenic
1165333813 19:35155466-35155488 GGAAAGGGCTGCAGGATCCCCGG + Exonic
1165999540 19:39870254-39870276 GGACAGGGATGCAGACACCCTGG + Exonic
1166455072 19:42933957-42933979 GATCTTGGATGCAGAATCCCAGG - Intronic
1166485118 19:43205914-43205936 GGTTAGGCAAGCAGAGTCCTGGG + Intronic
1166926592 19:46273114-46273136 GGTTTGGGATGCAGTTTGCCTGG - Intergenic
1167333224 19:48868954-48868976 GGTTAGGGATCCAGACTCCTGGG + Intergenic
1167971882 19:53192895-53192917 GGTGGGGTATGCAGGATCCCAGG + Intronic
1168026539 19:53647765-53647787 GGTTAGGGATGTGGAGACCCTGG - Intergenic
1168204536 19:54839893-54839915 GATTAGGGCTCCAGAAACCCAGG + Intronic
924998772 2:387019-387041 GGTGAGGGGGGCAGAAGCCCAGG - Intergenic
925635619 2:5938651-5938673 GGTAAGGAATGCAGAATGGCAGG - Intergenic
925659831 2:6190670-6190692 GGAGAGGGAAGCAGAAGCCCTGG + Intergenic
926761820 2:16284902-16284924 CATTAGGAATGCAGAATCTCGGG + Intergenic
928179494 2:29058013-29058035 ATTTAGGGATGCTGACTCCCAGG - Exonic
928732920 2:34253503-34253525 TGTTAAAAATGCAGAATCCCAGG + Intergenic
929623626 2:43383668-43383690 GGTTAGAAATGCAGAATCTTGGG - Intronic
929884354 2:45865136-45865158 GGTTAGAAAAGCAGAATCTCAGG - Intronic
929941415 2:46336775-46336797 TGTTAGGAAGGCAGAATCCCAGG + Intronic
931009335 2:57890408-57890430 TGTTAGAAATGCACAATCCCAGG - Intergenic
931087325 2:58847285-58847307 TGTTTGGAATGCAGAATCTCAGG + Intergenic
931219296 2:60274738-60274760 TGATAGAAATGCAGAATCCCAGG + Intergenic
931700116 2:64902510-64902532 TGTTAGAAATGCAGATTCCCAGG - Intergenic
931761516 2:65421428-65421450 TGTTAAGAATGCAGAATCTCAGG + Intronic
931789039 2:65647027-65647049 TGTTAGATGTGCAGAATCCCAGG + Intergenic
931936747 2:67206679-67206701 TGTTAGAAATGCAGAATCTCAGG - Intergenic
932167546 2:69522077-69522099 TGTGAGGGGTGCAGAAGCCCAGG + Intronic
932442297 2:71745260-71745282 GGTTTGGGTCTCAGAATCCCAGG + Intergenic
932614501 2:73223380-73223402 GGTTGGGGAGGCAGAAGCCCAGG - Intronic
932628332 2:73317056-73317078 TGTTAGGGAAGCAGGAGCCCAGG - Intergenic
932705583 2:74021693-74021715 GGTTATGGATGCAGATTCCCAGG - Intronic
932722292 2:74147095-74147117 GGTGAGCGTTGCAGAATCCTTGG + Intronic
933279373 2:80315913-80315935 TGTTAGAAATGCAGAATCTCAGG + Intronic
933566963 2:83962083-83962105 GGTTAGAAATGCAGAATCCCAGG - Intergenic
933620044 2:84528235-84528257 GGTTAGAAAGGCAGAATCTCAGG + Intronic
933788823 2:85867281-85867303 GGTTAGAAATGCAGAGTCTCAGG + Intronic
933846301 2:86329693-86329715 AGTTAGGAATGCAGAGTCCCAGG - Intronic
934897754 2:98133215-98133237 GGTTAGGAATACACACTCCCAGG - Intronic
935538174 2:104318594-104318616 TGTTAGAAATGCAGAATCTCAGG + Intergenic
936328357 2:111524859-111524881 TGTTAGGAATGCAGAATCCTAGG - Intergenic
936348187 2:111691094-111691116 GGCAAGCGCTGCAGAATCCCAGG - Intergenic
936394077 2:112106330-112106352 TGTTAGAGATGCAGAGTCTCAGG + Intronic
936664889 2:114582998-114583020 TGTTAGAAATGCAGATTCCCAGG - Intronic
936992062 2:118376953-118376975 GGTTAGAAATGCAGAATCTCAGG - Intergenic
937120609 2:119437839-119437861 GATAGGGGCTGCAGAATCCCTGG + Exonic
937122284 2:119449107-119449129 TGTTAGAAATGCAGAATCTCAGG - Intronic
937266727 2:120621007-120621029 TGGTAGGGAAGCAGAATTCCAGG + Intergenic
937516720 2:122663838-122663860 GGTGGTGGCTGCAGAATCCCGGG + Intergenic
938569079 2:132545790-132545812 TGTTAGAAATGCAGAATCCCAGG - Intronic
938966733 2:136395268-136395290 TGTTAGAAATGCAGAATCTCAGG + Intergenic
940725323 2:157329957-157329979 GTTTAGGGTTGCACATTCCCTGG - Intergenic
940781056 2:157934022-157934044 TGTTAAAAATGCAGAATCCCAGG - Intronic
941327660 2:164136932-164136954 TGTTAGAAATGCAGAATCTCAGG + Intergenic
941902424 2:170691291-170691313 GGTTCTGGAGGCAGACTCCCTGG - Intergenic
941906835 2:170724797-170724819 GGTTAGAAATGCAGATTCTCGGG + Intergenic
942102843 2:172603084-172603106 TGTTAGAAATGCAGAATCTCAGG - Intronic
942485889 2:176439534-176439556 GGTAAGGGATGCCAAGTCCCTGG - Intergenic
942624505 2:177885279-177885301 GGTTGTGGATGCAGAACCCATGG - Intronic
942631563 2:177955579-177955601 TGTTAGAAATGCAGAATCTCAGG - Intronic
942926390 2:181438307-181438329 TGTTAGAAATGCAGAATCTCAGG + Intergenic
944234211 2:197426722-197426744 TGTTAATGATGCAGAATCCTGGG - Intronic
944345264 2:198657342-198657364 GGTTAGGGATGAAGAAAATCAGG + Intergenic
945488225 2:210423810-210423832 TGTTAGAAATGCAGAATCTCAGG + Intergenic
946445279 2:219734112-219734134 TGCTAGAGATGCAGAATCCCAGG + Intergenic
948753003 2:240143325-240143347 GGTTAGGGATGCAGAATCCCAGG - Intronic
1169167390 20:3435883-3435905 AGTTATATATGCAGAATCCCAGG - Intergenic
1169302969 20:4461454-4461476 TGTTAGTAATGCAGAATCCTGGG + Intergenic
1169325161 20:4669913-4669935 GGTTAGAAAGGCAGAATCTCAGG - Intergenic
1169415673 20:5414050-5414072 GGTTAGAAATGCAGATTCTCAGG - Intergenic
1169703514 20:8475991-8476013 TGTTAGAAATGCAGAATCTCAGG - Intronic
1169713934 20:8594485-8594507 AGGTAGGGATGCAGAATCTCAGG - Intronic
1169767895 20:9168560-9168582 TGTTAGCAATGCAGAATCTCAGG - Intronic
1169784615 20:9346193-9346215 TATTAGAGATGCAGATTCCCAGG + Intronic
1169785791 20:9358012-9358034 TGTTAGGAATGCAGAGTCCCAGG - Intronic
1169806126 20:9560940-9560962 TGTTAGAAATGCAGAATCTCAGG - Intronic
1169832503 20:9839424-9839446 TGTTAGGCTTGCAGAATCTCAGG - Intergenic
1170575024 20:17655938-17655960 GCTTAGAAATGCAGAATCTCAGG + Intronic
1170581717 20:17704331-17704353 TGTTAGGAATGCAGAATCTCAGG - Intronic
1170918555 20:20653261-20653283 TGTTAGAGATGCAGAATCTCAGG - Intronic
1171175120 20:23046471-23046493 GGTTAGAAATGCAGAATCCTAGG - Exonic
1172068541 20:32239151-32239173 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1172488078 20:35311590-35311612 TGTTAGCAATGCAGAATCTCAGG + Intronic
1172753823 20:37269707-37269729 TGTTAGGAATGCAGAATGTCAGG + Intergenic
1173217248 20:41096569-41096591 GTTTAGAAATGCAGAATCCCAGG - Intronic
1173371821 20:42443345-42443367 TGTTAGAGATGCAGAATCGCAGG - Intronic
1173563147 20:44020649-44020671 TGTTAGAGATGCAGATTCTCAGG + Intronic
1174674365 20:52339342-52339364 TATTAGGAATGCAGAATCTCAGG - Intergenic
1174740816 20:53012410-53012432 TGTTAGGAATGCACAATCTCAGG + Intronic
1175124914 20:56744164-56744186 GTTTATGGATGCAGAAACCCAGG + Intergenic
1175307772 20:57989081-57989103 TGTTAGGAATGCAAAATCTCAGG + Intergenic
1176520965 21:7823961-7823983 TGTTAGGAATGCAGATTCCCAGG - Intronic
1178654986 21:34453973-34453995 TGTTAGGAATGCAGATTCCCAGG - Intergenic
1179098893 21:38339036-38339058 TGTTAGGGAAGCAGGAGCCCAGG + Intergenic
1179165683 21:38933547-38933569 TGTTAGCAATGCAGAATCCCAGG - Intergenic
1179221608 21:39412875-39412897 GGTAAGGGAAGCACAATCTCTGG - Intronic
1179348754 21:40586592-40586614 GGTCAGGAATGCAAAATCTCAGG - Intronic
1179436952 21:41368874-41368896 GGCTAGGGGTTCAGAGTCCCAGG + Intronic
1180047704 21:45317439-45317461 GGGTAGAAATGCAGAGTCCCAGG - Intergenic
1180653503 22:17398997-17399019 TGTTAGAAATGCAGAATCTCAGG + Intronic
1180719523 22:17897002-17897024 GGGTAGGGATGGAGAAGCTCTGG + Intronic
1181880498 22:25975764-25975786 GGTTGGAAATGCAGAATCTCAGG - Intronic
1182097683 22:27637184-27637206 GTTTTAGGATGCAGATTCCCTGG - Intergenic
1183624807 22:38995339-38995361 GGCTGTGGATGCAGAATTCCTGG + Intergenic
1184316647 22:43698425-43698447 GGTGATGGATACAGCATCCCGGG - Intronic
1184348626 22:43928428-43928450 GGGGAGGGACGCAGAATCTCTGG + Intronic
1184429090 22:44430751-44430773 GGCTGAGGATGGAGAATCCCTGG - Intergenic
1184987586 22:48146080-48146102 AGCCAGGGCTGCAGAATCCCAGG - Intergenic
949282036 3:2357126-2357148 GGTTAGAAATGCAAAATCTCAGG - Intronic
949330610 3:2917492-2917514 TGTTAGAAATGCAGAATTCCAGG - Intronic
949741017 3:7234413-7234435 GGTTAGGGAATCAGAGGCCCAGG - Intronic
950225542 3:11230587-11230609 TGTTAGAGATGCAGAATCTCTGG + Intronic
951190419 3:19762684-19762706 TGTTGGAGATGCAGAATCTCAGG + Intergenic
951519609 3:23599103-23599125 GGTTAGAAATGCAGAATCTTGGG + Intergenic
951596440 3:24323525-24323547 GGTTAGGAATGCAGAATCTCAGG - Intronic
951630434 3:24714231-24714253 GGTTAGAAATGCAGGATCTCAGG - Intergenic
952227708 3:31395993-31396015 TGTTAGAAATGCAGAATCTCAGG - Intergenic
952713913 3:36458928-36458950 TGTTAGGAATGCAGAATCTCAGG - Intronic
952847074 3:37696888-37696910 TGTTAGAAATGCAGAATCTCAGG + Intronic
953417533 3:42731515-42731537 TGTTAGAAATGCAGAATCCCAGG + Intronic
953831161 3:46298592-46298614 TGCTAGGAATGCAGAATCTCAGG + Intergenic
953989121 3:47470376-47470398 GGCTTGGGATGGAGAAACCCAGG + Intronic
955488550 3:59459628-59459650 TGTTAGAAATGCAGAATCTCAGG + Intergenic
955552439 3:60098881-60098903 GGTTAGGGGTGCTGACTCCCAGG - Intronic
955991449 3:64632132-64632154 GGTCAGGAATGCAGAATTTCAGG + Intronic
956200774 3:66703202-66703224 TGTTAGAGATGCAGAATCTCAGG - Intergenic
956238543 3:67103811-67103833 GCTCAGGGCTGCAGAATCCTGGG - Intergenic
956249903 3:67224908-67224930 GATTAGAAATGCAGAATCTCAGG + Intergenic
956595218 3:70959832-70959854 TGTTAGAGATGCAGAGTCTCAGG - Intronic
956729915 3:72187104-72187126 AGTTGGAAATGCAGAATCCCAGG + Intergenic
956732570 3:72210089-72210111 GATCAGAGATGCAGAATCTCAGG - Intergenic
956861101 3:73324467-73324489 GGTTAGAAATGCAGAATCCCAGG - Intergenic
956903096 3:73737064-73737086 GGTTAGAAATGCAGACTCTCAGG + Intergenic
957769130 3:84665636-84665658 TGTTAGGAATGCAGAATTTCAGG + Intergenic
958477038 3:94597718-94597740 GGTTAGGCTTACAGAATCACAGG + Intergenic
958788424 3:98623972-98623994 TGTTAGAAATGCAGAATCTCAGG + Intergenic
958883525 3:99700076-99700098 GGTTAGAAATGCAGAGTCTCCGG - Intronic
959677446 3:109052426-109052448 TGTTAGAAATGCAGAATCCCAGG - Intronic
961074560 3:123969774-123969796 TGTTAGAAATGCAGAATCTCAGG - Intronic
961256494 3:125558888-125558910 TGTTAGGAATGCAGAATCTCAGG - Intronic
961309122 3:125982684-125982706 TGTTAGAAATGCAGAATCTCAGG + Intronic
962099790 3:132329801-132329823 TGTTAGACATGCAGAATCGCAGG - Intronic
962165593 3:133044569-133044591 GGTTAGAAATGCAGAATCTCTGG + Intronic
962478368 3:135777751-135777773 GGTTTGGGATCCAGATTGCCTGG - Intergenic
962547332 3:136450273-136450295 TGTTAGAAATGCAGAATCTCAGG + Intronic
963001459 3:140685478-140685500 TGTTAGAAATGCAGAATCTCAGG + Intronic
963272601 3:143300562-143300584 GCTTAGAAATGCAGAATCTCAGG - Intronic
963852897 3:150225501-150225523 GGTCAGAAATGCAGAATCTCGGG + Intergenic
966252369 3:177880648-177880670 TGTTAGACATGCAGAATTCCAGG - Intergenic
966385488 3:179393329-179393351 TGTTAGAAATGCACAATCCCGGG + Exonic
966557061 3:181274466-181274488 TGTTAGAAATGCAGAATCTCAGG + Intergenic
967081512 3:186054125-186054147 GGTGAGGGCTACAGAATCACAGG - Intronic
967123862 3:186407369-186407391 TGTTTGGGAGGCAGCATCCCAGG + Intergenic
967977807 3:195045140-195045162 TGTTACAGATGCAGATTCCCAGG + Intergenic
971301102 4:25443005-25443027 GGTTAGGAATGCAAAATCTCAGG + Intergenic
971995035 4:33954805-33954827 GGTCAAGGATGGAGGATCCCAGG + Intergenic
972321031 4:37973927-37973949 GGTTAGAAATGCAGAATCTCAGG - Intronic
972858150 4:43132985-43133007 TGTTAGGAATGCAGAATCTCAGG - Intergenic
972904324 4:43726631-43726653 GTGTAGGGAAGCAGAATTCCTGG - Intergenic
972974735 4:44620258-44620280 TGTTAGGAATTCAGAATCTCAGG - Intergenic
973588366 4:52414554-52414576 GGTTAGGGATGCTGAATGCCTGG - Intergenic
973885998 4:55322339-55322361 TGTTAGAAATGCAGAATCCCTGG + Intergenic
973908481 4:55554151-55554173 TGTTAGAAATGCAGAATCTCTGG - Intergenic
974431067 4:61796519-61796541 GGATAGGGTTGGAGAATCACTGG + Intronic
974823210 4:67094651-67094673 TGTTAGAAATGCAGAATCTCAGG - Intergenic
976137104 4:81950287-81950309 GGTTAGAAATGTAGAATCTCAGG + Intronic
976678290 4:87726800-87726822 GATTAGGGATGCAGAAGCTTTGG - Intergenic
977958182 4:103054370-103054392 GCTTAGAAATGCAGAATCTCAGG + Intronic
981143570 4:141299760-141299782 TGTTAGAAATGCAGAATCTCAGG - Intergenic
982082968 4:151808048-151808070 TGTTAGAAATGCAGAATCCCAGG + Intergenic
982148420 4:152425011-152425033 TGTTAGAAATGCAGAATCTCGGG - Intronic
982222965 4:153140614-153140636 GGTAAGGGCTGCCGCATCCCGGG - Intergenic
984063169 4:175017251-175017273 GGAAAGGGATCCAGAATCCCTGG + Intergenic
984601150 4:181728460-181728482 GGAAAGGGATGGAGATTCCCTGG + Intergenic
984923619 4:184787339-184787361 GGCTAGGGGGGCAGAATGCCAGG + Intronic
984951828 4:185013673-185013695 CGTTAGGAATGCAGAATCATAGG - Intergenic
985029818 4:185778312-185778334 TGTTAGGGATGCAGAATTTCAGG - Intronic
985144826 4:186885776-186885798 TGTCAGGGATGCCAAATCCCAGG - Intergenic
985838264 5:2286663-2286685 GGTTAGGAAAGCAGAAAGCCAGG - Intergenic
985844949 5:2337003-2337025 GCAGAGGGATGGAGAATCCCAGG + Intergenic
986023245 5:3824699-3824721 GGATGGAGATGCAGAAACCCTGG + Intergenic
986363597 5:7006631-7006653 TGTTAGTGATGCAGAATTTCAGG - Intergenic
990990719 5:61681146-61681168 GTTTAAAGTTGCAGAATCCCAGG + Intronic
991587128 5:68212984-68213006 TGTTAGAAAGGCAGAATCCCAGG - Intergenic
991721219 5:69495384-69495406 TGTTAGAAAGGCAGAATCCCAGG - Intronic
991948351 5:71923536-71923558 AGTTAAGGATACAGATTCCCAGG + Intergenic
992382470 5:76251637-76251659 TGTTAGAGATGCAAATTCCCTGG - Intronic
992453160 5:76891557-76891579 TGTTAGGAATGCAGAATCTCAGG - Intronic
992626185 5:78637757-78637779 TGTTAGAGATACAGAATCCTAGG + Intronic
993347590 5:86804246-86804268 TGTTAGAAATGCAGAATCTCAGG - Intergenic
995677948 5:114684552-114684574 TGTTAGAAATGCAGAATCTCGGG - Intergenic
997256507 5:132432627-132432649 GGTTAAGGAAGGAGAATCGCTGG - Intronic
998240507 5:140439049-140439071 TGTGAGAAATGCAGAATCCCGGG + Intronic
998868409 5:146529047-146529069 TGTTAGAAATGCAGAATCCCAGG + Intergenic
999324077 5:150632234-150632256 TGTTAGAAATGCAGAATCCCAGG + Intronic
999417293 5:151409615-151409637 TGTCAGGAATGCAGAATCTCAGG + Intergenic
999630716 5:153568342-153568364 TGTTAGAAATGCAGAATCTCAGG + Intronic
999707973 5:154291387-154291409 TGTTAGAAATGCAGAATCTCAGG + Intronic
999975985 5:156912586-156912608 TATTAGAAATGCAGAATCCCAGG - Intergenic
1000957494 5:167560145-167560167 GGTTAGCAATACAGAATCCCAGG + Intronic
1001100031 5:168806636-168806658 GGTTAAGGACACAGAAGCCCAGG - Intronic
1001244267 5:170094198-170094220 TGTTAGGAATACAGAATCTCAGG + Intergenic
1001599115 5:172917460-172917482 TGTTAGGAATGCAGATTCTCAGG + Intronic
1002076342 5:176710707-176710729 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1002185003 5:177450294-177450316 GGGTGGGGATGGAAAATCCCGGG - Intronic
1002616882 5:180461581-180461603 GGCTGGGGATGCACATTCCCAGG - Intergenic
1003183827 6:3813637-3813659 GGTTAGAAATGCAGGATCTCAGG - Intergenic
1003373701 6:5553791-5553813 TGTTAGAAATGCAGAATCCCAGG - Intronic
1003533238 6:6955012-6955034 TGTTAGGAATGCAGAATCTCAGG + Intergenic
1004084141 6:12427904-12427926 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1004109316 6:12699776-12699798 TGTTAGACATGCAGAATCCCAGG - Intergenic
1004156786 6:13176052-13176074 GGGTAGGCAAGCAGAAGCCCTGG + Intronic
1004450953 6:15745878-15745900 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1005232774 6:23723401-23723423 TGTCAGAAATGCAGAATCCCAGG - Intergenic
1006381533 6:33700754-33700776 GGTTAGAAATGCAGAATCAGGGG - Intronic
1006839024 6:37016220-37016242 GGTTAGAAATGCAGGATCTCAGG - Intronic
1006917256 6:37602558-37602580 GGCTAGAGATGCAGAATTTCAGG + Intergenic
1007080302 6:39096344-39096366 GGTTAGAAATGCAGAATCTCAGG + Intergenic
1007451426 6:41942398-41942420 GGTTAGAAATGCAGACTCTCAGG + Intronic
1007454697 6:41967602-41967624 GGATAGAAATGCAGATTCCCGGG - Intronic
1007497726 6:42272486-42272508 GGTTAGAAATGCAGAATCTCAGG + Intronic
1007506325 6:42337965-42337987 TGTTAGGGATGCGGAGTCTCAGG + Intronic
1007648853 6:43404168-43404190 GGTTAAGGATGCAGCATCTCTGG + Intergenic
1007716241 6:43857775-43857797 GGTAAGGGATGCCGAGGCCCAGG + Intergenic
1008364290 6:50658222-50658244 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1008486451 6:52041358-52041380 TGTTAGAGATGCAGAGTCTCAGG - Intronic
1008498503 6:52156513-52156535 GGTTAGGGAGGTTGAAGCCCAGG - Intergenic
1008682819 6:53892143-53892165 GGTTAAGAATGCAGATTCCCTGG + Intronic
1010569032 6:77455741-77455763 TATTAGGAATGCAGAATACCAGG + Intergenic
1010694993 6:78961502-78961524 TGTTAGAAATGCAGAATCTCAGG + Intronic
1011093927 6:83637406-83637428 GGGTTGGGGTGAAGAATCCCTGG + Intronic
1011938423 6:92812096-92812118 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1011966679 6:93167013-93167035 TGTTAGAAATGCAGAATCCCAGG + Intergenic
1012389179 6:98717544-98717566 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1012835464 6:104259521-104259543 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1012921658 6:105226364-105226386 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1012949827 6:105505965-105505987 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1013024321 6:106254845-106254867 TGTGAGTGATGCAGACTCCCTGG - Intronic
1013167327 6:107605813-107605835 TGTTAAGCATGGAGAATCCCAGG + Intronic
1013312396 6:108908147-108908169 TATTAGGAATGCAGAATCTCAGG - Intronic
1013655501 6:112242573-112242595 TGTTAGAGATGCAGAACCTCAGG - Intronic
1013760918 6:113516550-113516572 TGTTAGCAATGCAGAATCTCAGG + Intergenic
1014284510 6:119481535-119481557 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1015864773 6:137717004-137717026 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1016868078 6:148789304-148789326 TGTTAGAAATGCAGAATCTCAGG + Intronic
1017561606 6:155634157-155634179 TGTTAGAAATGCAGAATCCAGGG - Intergenic
1019200210 6:170307649-170307671 GGTTAGGGATGGGGAATGGCAGG + Intronic
1019525814 7:1479955-1479977 GGTGAGGCCTGCAGGATCCCCGG + Intronic
1019740613 7:2671168-2671190 GGTGGGGAATGCAGATTCCCAGG - Intergenic
1020390290 7:7650715-7650737 GGTTCAGGATGCAGAATGGCTGG - Intronic
1020762142 7:12281883-12281905 TGTTAGAAATGCAGAATTCCAGG - Intergenic
1020912838 7:14154994-14155016 TGTTAGAAATGCAGACTCCCCGG + Intronic
1021521768 7:21545776-21545798 GGTTAGAAATGCAGAACCTCGGG - Intronic
1021561569 7:21972724-21972746 GGTTAGGGCTGCATACTCCATGG - Intergenic
1021603692 7:22389895-22389917 GGTTAGAGATGCAGAATCCCAGG - Intergenic
1021682778 7:23151535-23151557 TGTTAGAAATGCTGAATCCCAGG - Intronic
1022093833 7:27125666-27125688 GTTTAGGGATGCAGAGACCAGGG + Intronic
1022265160 7:28746448-28746470 CTTTAGGAATGCAGAATCCCTGG + Intronic
1022273910 7:28837932-28837954 GGTTAGCCATGCAGAGTCTCAGG + Intergenic
1022377285 7:29826330-29826352 TGTTAGAAATGCAGAATCCCAGG + Intronic
1022535937 7:31098491-31098513 TCTTAGAAATGCAGAATCCCAGG - Intronic
1022566944 7:31413275-31413297 CTTTAGGGATGCAGGAACCCAGG - Intergenic
1022625596 7:32032778-32032800 CGTTAGACATGCAGAATCTCAGG + Intronic
1022834495 7:34100980-34101002 TGTTAGAAATGCAGACTCCCAGG + Intronic
1023045758 7:36208846-36208868 TGTTAGGAATGCAGATTCTCAGG + Intronic
1023081298 7:36528950-36528972 GGTTATAAATGCAGAATTCCAGG - Intronic
1023530874 7:41152675-41152697 GATGAGGGCTGCAGAATGCCTGG - Intergenic
1024047499 7:45595256-45595278 TGTTAGGAATGCAGATTACCAGG + Intronic
1024376429 7:48643868-48643890 TGTTAGACATGCAGAATCACAGG + Intronic
1025929527 7:65982651-65982673 GGTCAGGGCTCCAGAAGCCCAGG - Intergenic
1026237255 7:68538160-68538182 GGTTAGGGATCAAGAAGCTCTGG - Intergenic
1026317925 7:69243453-69243475 GGTTAGAAATGCAGATTCTCAGG + Intergenic
1027251110 7:76399353-76399375 TGTTAGCGATGCAGATTCTCAGG + Intronic
1028936321 7:96468347-96468369 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1029982008 7:104887531-104887553 GGTAAGGGATGGTGATTCCCTGG + Intronic
1030059612 7:105612422-105612444 TGTTAGAAATGCAGACTCCCAGG + Intronic
1030741614 7:113116411-113116433 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1031009948 7:116515467-116515489 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1031137042 7:117895987-117896009 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1032285937 7:130538515-130538537 CGGTAGGGAGGCAAAATCCCAGG + Intronic
1032598090 7:133262654-133262676 TGTTAGAAATGCAGAATCTCAGG + Intronic
1032821574 7:135528893-135528915 TGTTAGACATGCAGAATCTCAGG + Intergenic
1034077896 7:148250156-148250178 GGTTAGCCCTGCAGAAACCCAGG - Intronic
1034784938 7:153917084-153917106 TGTTAGAAATGCAGAATCCCAGG - Intronic
1035009336 7:155699289-155699311 TGTTAGAAATGCAGAACCCCAGG + Intronic
1035676582 8:1460978-1461000 GTTTATGGAGGCAGAAACCCAGG - Intergenic
1035756120 8:2034243-2034265 GGAAGGGGATGCAGAAACCCAGG - Intergenic
1036446983 8:8830010-8830032 TATTAGGAATGCAGAATCCCAGG - Intronic
1037332958 8:17762825-17762847 GGATAGAAATGCAGAATCTCAGG - Intronic
1037700874 8:21272825-21272847 TATTAGGAATGCAGAATCTCAGG - Intergenic
1038500754 8:28041689-28041711 GGCTAGAAATGCAGAATCCCAGG - Intronic
1039862013 8:41467251-41467273 GGTTAGAAATGCAGAGTCTCAGG + Intergenic
1040603686 8:48909596-48909618 GGTTAGAAATGCAGATTCTCAGG + Intergenic
1041015341 8:53587608-53587630 TGTTAAATATGCAGAATCCCAGG + Intergenic
1042477930 8:69270261-69270283 TGTTAGAAATGCAGAATCCTGGG - Intergenic
1042549288 8:69980181-69980203 GGTTAGAAATGCAAATTCCCGGG + Intergenic
1042820456 8:72924485-72924507 GATTAGAAATGCAGAATCTCAGG - Intronic
1043870919 8:85431477-85431499 GGTTAGGGATTCTGAGTCACAGG + Intronic
1044386067 8:91590166-91590188 GGTTAGAAATGCAAAATCTCAGG + Intergenic
1044933577 8:97273086-97273108 CGTTAGAAATGCAGAATCTCAGG + Intergenic
1044934451 8:97279250-97279272 TGTTAAAGATGCAGAATCTCAGG + Intergenic
1045281917 8:100756859-100756881 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1045671866 8:104564320-104564342 GGTTAGAAATGCTGAATCTCAGG - Intronic
1046798928 8:118403407-118403429 GATTAGGGAATAAGAATCCCTGG + Intronic
1047371834 8:124262347-124262369 TGTTAGGAATGCAGATTCTCAGG - Intergenic
1047380267 8:124355505-124355527 TGTTAGAAATGCAGAATCTCAGG + Intronic
1047516267 8:125557114-125557136 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1048261614 8:132950000-132950022 GGTTAGAAATGCAGAGTCTCAGG + Intronic
1049308844 8:141922717-141922739 TGTTAGAAATGCAGACTCCCAGG - Intergenic
1049691077 8:143959457-143959479 GGTCCGGGATGCAGAGGCCCAGG + Intronic
1050224342 9:3434079-3434101 TGTTAGAAATGCAGAATCTCAGG - Intronic
1050467664 9:5947279-5947301 TGTTAGAAATGCAGAATCCAAGG - Intronic
1050838415 9:10113790-10113812 TGTTAGAAATGCAGAATCACAGG - Intronic
1051713819 9:19960687-19960709 GGTTAGGAATGCAGAATGCTGGG + Intergenic
1051827209 9:21233802-21233824 GAATAGGGATGCAGATTCTCAGG - Intronic
1052379000 9:27749882-27749904 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1052556911 9:30030513-30030535 TGTTAGAGATGAAGAATCACAGG - Intergenic
1053439047 9:38099608-38099630 GGTTTGGGATGGAGAATCAAGGG - Intergenic
1053524399 9:38813951-38813973 CGTTAGGGAAGCAGAAGCCTAGG + Intergenic
1054196633 9:62038360-62038382 CGTTAGGGAAGCAGAAGCCTAGG + Intergenic
1054641772 9:67550325-67550347 CGTTAGGGAAGCAGAAGCCTAGG - Intergenic
1055286193 9:74730652-74730674 GGTTAGACATGCAAAATCTCAGG - Intronic
1055704754 9:78985558-78985580 TGTTAGACATGCAGAATCTCAGG - Intergenic
1055839720 9:80488674-80488696 GTCTATGGATGCAGATTCCCAGG - Intergenic
1056036181 9:82608505-82608527 TGTTGGAGATGCAGAATTCCAGG - Intergenic
1056067084 9:82947654-82947676 TGTTAGAAATTCAGAATCCCAGG - Intergenic
1056541720 9:87577230-87577252 GGTTAGAAATGCAGATTCTCAGG + Intronic
1056742091 9:89266246-89266268 TGTTAGGCATGCAGATTCTCAGG - Intergenic
1056835181 9:89949175-89949197 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1057794976 9:98149303-98149325 TGTTGGAGATGCAGATTCCCTGG + Intronic
1057819184 9:98318225-98318247 GCTTAGAAATGCAGCATCCCAGG - Intronic
1057836771 9:98451650-98451672 TGTTAGAGATGCACATTCCCAGG - Intronic
1057944095 9:99309587-99309609 TGTTTGAAATGCAGAATCCCAGG - Intergenic
1058083832 9:100727541-100727563 TGTTAAAGATGCAGATTCCCAGG - Intergenic
1058582277 9:106471356-106471378 GATGAGGGATGCAGCATCTCTGG - Intergenic
1058750963 9:108037821-108037843 GGTTAGGGAGCTAGAATCCGTGG + Intergenic
1059565336 9:115378835-115378857 GGTTAGAAATGCAGATTCTCAGG - Intronic
1059716439 9:116917566-116917588 TGTTAGAAATGCAGAATCCCAGG + Intronic
1061432855 9:130542362-130542384 GGTGATGGATGCAAAAGCCCTGG - Intergenic
1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG + Intronic
1186249042 X:7646310-7646332 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1186516544 X:10170594-10170616 TGTTAGAAATGCAGATTCCCCGG + Intronic
1186663799 X:11698068-11698090 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1186683145 X:11896897-11896919 TGCTAGAAATGCAGAATCCCAGG - Intergenic
1186874547 X:13804149-13804171 CGTTAGAAATGCAGAGTCCCAGG - Intronic
1186884385 X:13898479-13898501 TGTCAGAAATGCAGAATCCCAGG + Intronic
1187021568 X:15387895-15387917 AGTTAGAAATGCAGAATCTCAGG - Intronic
1187232750 X:17438181-17438203 TGTGAGAAATGCAGAATCCCAGG - Intronic
1187427331 X:19190143-19190165 GGTTAAAAATGCAGATTCCCAGG - Intergenic
1187473621 X:19590401-19590423 GGTGAGGGACGTAGAATCCCTGG - Intronic
1187581028 X:20607508-20607530 TGTTGGAGATGCAGAATCTCAGG - Intergenic
1187688602 X:21841022-21841044 TGTTAGAAATGCAGAATCCCAGG + Intronic
1188353716 X:29163323-29163345 TGTTAGAAATGCAGACTCCCAGG - Intronic
1188452185 X:30319294-30319316 TGTTAGGAATGCAGAAGCTCAGG + Intergenic
1188517417 X:31002566-31002588 TCTTAGAGATGCACAATCCCAGG + Intergenic
1188567985 X:31548240-31548262 GGTTAGCAATGCAGAATCGCAGG + Intronic
1188580145 X:31701791-31701813 TGTTAGAAATGCAGAATCTCAGG + Intronic
1188650362 X:32624619-32624641 TGTTAGAAATGCAGAATCTCAGG - Intronic
1188993654 X:36855169-36855191 AGTTAGAAATGCAGAATCTCAGG + Intergenic
1189047871 X:37612309-37612331 GGTTAGAAATGCAGATTTCCAGG - Intronic
1189088563 X:38053176-38053198 TTTTAGGAATGCAGAATCTCAGG - Intronic
1189094809 X:38126804-38126826 TGGCAGGGAAGCAGAATCCCAGG - Exonic
1189211927 X:39290953-39290975 GGTTAGAAATGCAGAATGTCAGG - Intergenic
1189565828 X:42240126-42240148 AGTTAGGGATACAGAAACACCGG - Intergenic
1190552679 X:51601010-51601032 AGCTAGGGATGCAGGATCCTGGG - Intergenic
1190577617 X:51856662-51856684 TGTTATGGATCCAGAATCCAAGG + Intronic
1192121678 X:68462397-68462419 GGTTAGGCATGCATAGTCACAGG + Intergenic
1192264205 X:69527815-69527837 TGTGAGAGATGCAGAATCTCAGG - Intronic
1194818707 X:98478782-98478804 TGTTAGAAATGCAGAATCCTGGG + Intergenic
1195598737 X:106722407-106722429 GGTTAGAAATGCAGAATCACAGG - Intronic
1196343191 X:114621179-114621201 GGTTAGAAATGCAGACTCTCAGG - Intronic
1196383916 X:115127078-115127100 GTTTAGAAATGCAGAATCTCAGG + Intronic
1198851441 X:140968806-140968828 TGTTGGGAATGCAGAATCTCAGG + Intergenic
1199463265 X:148107295-148107317 TGTTAGAAATGCAGAATCTCAGG + Intergenic