ID: 948754155

View in Genome Browser
Species Human (GRCh38)
Location 2:240149520-240149542
Sequence GAGCCCCCTGGGCGTTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948754155_948754160 9 Left 948754155 2:240149520-240149542 CCATAAGAACGCCCAGGGGGCTC No data
Right 948754160 2:240149552-240149574 TGGCTCTCAAAGATAAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948754155 Original CRISPR GAGCCCCCTGGGCGTTCTTA TGG (reversed) Intergenic
No off target data available for this crispr