ID: 948754594

View in Genome Browser
Species Human (GRCh38)
Location 2:240151535-240151557
Sequence AGCCCTATGATGCTTCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948754586_948754594 18 Left 948754586 2:240151494-240151516 CCTGCAGTGGCCAGTGGAGACTG No data
Right 948754594 2:240151535-240151557 AGCCCTATGATGCTTCTGAGAGG No data
948754591_948754594 8 Left 948754591 2:240151504-240151526 CCAGTGGAGACTGGGACTCGGGA No data
Right 948754594 2:240151535-240151557 AGCCCTATGATGCTTCTGAGAGG No data
948754585_948754594 19 Left 948754585 2:240151493-240151515 CCCTGCAGTGGCCAGTGGAGACT No data
Right 948754594 2:240151535-240151557 AGCCCTATGATGCTTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948754594 Original CRISPR AGCCCTATGATGCTTCTGAG AGG Intergenic
No off target data available for this crispr