ID: 948754676

View in Genome Browser
Species Human (GRCh38)
Location 2:240151895-240151917
Sequence CAGATATGGAAGCTGAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948754676_948754682 25 Left 948754676 2:240151895-240151917 CCATACCTCAGCTTCCATATCTG No data
Right 948754682 2:240151943-240151965 TCCAGGAAGCTCCTGGCATGTGG No data
948754676_948754679 -4 Left 948754676 2:240151895-240151917 CCATACCTCAGCTTCCATATCTG No data
Right 948754679 2:240151914-240151936 TCTGAGAAGAGTAAAACAATAGG No data
948754676_948754680 8 Left 948754676 2:240151895-240151917 CCATACCTCAGCTTCCATATCTG No data
Right 948754680 2:240151926-240151948 AAAACAATAGGATTGTGTCCAGG No data
948754676_948754681 18 Left 948754676 2:240151895-240151917 CCATACCTCAGCTTCCATATCTG No data
Right 948754681 2:240151936-240151958 GATTGTGTCCAGGAAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948754676 Original CRISPR CAGATATGGAAGCTGAGGTA TGG (reversed) Intergenic
No off target data available for this crispr