ID: 948754678

View in Genome Browser
Species Human (GRCh38)
Location 2:240151909-240151931
Sequence TGTTTTACTCTTCTCAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948754678_948754681 4 Left 948754678 2:240151909-240151931 CCATATCTGAGAAGAGTAAAACA No data
Right 948754681 2:240151936-240151958 GATTGTGTCCAGGAAGCTCCTGG No data
948754678_948754682 11 Left 948754678 2:240151909-240151931 CCATATCTGAGAAGAGTAAAACA No data
Right 948754682 2:240151943-240151965 TCCAGGAAGCTCCTGGCATGTGG No data
948754678_948754680 -6 Left 948754678 2:240151909-240151931 CCATATCTGAGAAGAGTAAAACA No data
Right 948754680 2:240151926-240151948 AAAACAATAGGATTGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948754678 Original CRISPR TGTTTTACTCTTCTCAGATA TGG (reversed) Intergenic
No off target data available for this crispr