ID: 948754682

View in Genome Browser
Species Human (GRCh38)
Location 2:240151943-240151965
Sequence TCCAGGAAGCTCCTGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948754677_948754682 20 Left 948754677 2:240151900-240151922 CCTCAGCTTCCATATCTGAGAAG No data
Right 948754682 2:240151943-240151965 TCCAGGAAGCTCCTGGCATGTGG No data
948754678_948754682 11 Left 948754678 2:240151909-240151931 CCATATCTGAGAAGAGTAAAACA No data
Right 948754682 2:240151943-240151965 TCCAGGAAGCTCCTGGCATGTGG No data
948754676_948754682 25 Left 948754676 2:240151895-240151917 CCATACCTCAGCTTCCATATCTG No data
Right 948754682 2:240151943-240151965 TCCAGGAAGCTCCTGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948754682 Original CRISPR TCCAGGAAGCTCCTGGCATG TGG Intergenic
No off target data available for this crispr