ID: 948757683

View in Genome Browser
Species Human (GRCh38)
Location 2:240168857-240168879
Sequence GAGAGCCCTGCTTGGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948757683_948757688 0 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757688 2:240168880-240168902 CTAGTTACTTCTCCAGCTGTGGG No data
948757683_948757697 25 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757697 2:240168905-240168927 CCTTGGGGTCAGGAGCAGCTTGG No data
948757683_948757698 26 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757698 2:240168906-240168928 CTTGGGGTCAGGAGCAGCTTGGG No data
948757683_948757693 10 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757693 2:240168890-240168912 CTCCAGCTGTGGGGGCCTTGGGG No data
948757683_948757687 -1 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757687 2:240168879-240168901 CCTAGTTACTTCTCCAGCTGTGG No data
948757683_948757690 2 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757690 2:240168882-240168904 AGTTACTTCTCCAGCTGTGGGGG No data
948757683_948757699 27 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757699 2:240168907-240168929 TTGGGGTCAGGAGCAGCTTGGGG No data
948757683_948757689 1 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757689 2:240168881-240168903 TAGTTACTTCTCCAGCTGTGGGG No data
948757683_948757695 15 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757695 2:240168895-240168917 GCTGTGGGGGCCTTGGGGTCAGG No data
948757683_948757692 9 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757692 2:240168889-240168911 TCTCCAGCTGTGGGGGCCTTGGG No data
948757683_948757691 8 Left 948757683 2:240168857-240168879 CCAGGGGCCCAAGCAGGGCTCTC No data
Right 948757691 2:240168888-240168910 TTCTCCAGCTGTGGGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948757683 Original CRISPR GAGAGCCCTGCTTGGGCCCC TGG (reversed) Intergenic
No off target data available for this crispr