ID: 948758345

View in Genome Browser
Species Human (GRCh38)
Location 2:240172591-240172613
Sequence TACGAGGCCACGCTGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948758339_948758345 29 Left 948758339 2:240172539-240172561 CCTCACCTGCAAGGACAACGTCT No data
Right 948758345 2:240172591-240172613 TACGAGGCCACGCTGTGAGGAGG No data
948758340_948758345 24 Left 948758340 2:240172544-240172566 CCTGCAAGGACAACGTCTGTTTG No data
Right 948758345 2:240172591-240172613 TACGAGGCCACGCTGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948758345 Original CRISPR TACGAGGCCACGCTGTGAGG AGG Intergenic
No off target data available for this crispr