ID: 948758637

View in Genome Browser
Species Human (GRCh38)
Location 2:240175323-240175345
Sequence TGATTCATTTGGAAGCGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948758637_948758639 8 Left 948758637 2:240175323-240175345 CCTTTACGCTTCCAAATGAATCA No data
Right 948758639 2:240175354-240175376 GCTTCTTCAAATGATCCCGATGG No data
948758637_948758640 9 Left 948758637 2:240175323-240175345 CCTTTACGCTTCCAAATGAATCA No data
Right 948758640 2:240175355-240175377 CTTCTTCAAATGATCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948758637 Original CRISPR TGATTCATTTGGAAGCGTAA AGG (reversed) Intergenic
No off target data available for this crispr