ID: 948762716

View in Genome Browser
Species Human (GRCh38)
Location 2:240202761-240202783
Sequence CTCTGCAAGGGTGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948762716_948762725 -9 Left 948762716 2:240202761-240202783 CCCTCCACCTCACCCTTGCAGAG No data
Right 948762725 2:240202775-240202797 CTTGCAGAGGGAGCTGGCTCTGG No data
948762716_948762733 27 Left 948762716 2:240202761-240202783 CCCTCCACCTCACCCTTGCAGAG No data
Right 948762733 2:240202811-240202833 CGGGCTGCTGCTGTGGTTTTGGG No data
948762716_948762732 26 Left 948762716 2:240202761-240202783 CCCTCCACCTCACCCTTGCAGAG No data
Right 948762732 2:240202810-240202832 TCGGGCTGCTGCTGTGGTTTTGG No data
948762716_948762731 20 Left 948762716 2:240202761-240202783 CCCTCCACCTCACCCTTGCAGAG No data
Right 948762731 2:240202804-240202826 CATCTCTCGGGCTGCTGCTGTGG No data
948762716_948762727 8 Left 948762716 2:240202761-240202783 CCCTCCACCTCACCCTTGCAGAG No data
Right 948762727 2:240202792-240202814 CTCTGGTCCCTCCATCTCTCGGG No data
948762716_948762726 7 Left 948762716 2:240202761-240202783 CCCTCCACCTCACCCTTGCAGAG No data
Right 948762726 2:240202791-240202813 GCTCTGGTCCCTCCATCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948762716 Original CRISPR CTCTGCAAGGGTGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr