ID: 948763752

View in Genome Browser
Species Human (GRCh38)
Location 2:240208970-240208992
Sequence AGCAGCCCGAGGAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948763748_948763752 -2 Left 948763748 2:240208949-240208971 CCTGGCAGAGCTGAGGCTCTGAG No data
Right 948763752 2:240208970-240208992 AGCAGCCCGAGGAGAGAGGGAGG No data
948763745_948763752 6 Left 948763745 2:240208941-240208963 CCTGCCTGCCTGGCAGAGCTGAG No data
Right 948763752 2:240208970-240208992 AGCAGCCCGAGGAGAGAGGGAGG No data
948763747_948763752 2 Left 948763747 2:240208945-240208967 CCTGCCTGGCAGAGCTGAGGCTC No data
Right 948763752 2:240208970-240208992 AGCAGCCCGAGGAGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948763752 Original CRISPR AGCAGCCCGAGGAGAGAGGG AGG Intergenic