ID: 948765291

View in Genome Browser
Species Human (GRCh38)
Location 2:240216289-240216311
Sequence ACCCAAGAAAAAGGGTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948765285_948765291 19 Left 948765285 2:240216247-240216269 CCACGCCTGTGGGGGGTCAGTCT No data
Right 948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG No data
948765284_948765291 20 Left 948765284 2:240216246-240216268 CCCACGCCTGTGGGGGGTCAGTC No data
Right 948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG No data
948765280_948765291 27 Left 948765280 2:240216239-240216261 CCGGATCCCCACGCCTGTGGGGG No data
Right 948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG No data
948765283_948765291 21 Left 948765283 2:240216245-240216267 CCCCACGCCTGTGGGGGGTCAGT No data
Right 948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG No data
948765287_948765291 -7 Left 948765287 2:240216273-240216295 CCAGACCAGAGACACGACCCAAG No data
Right 948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG No data
948765286_948765291 14 Left 948765286 2:240216252-240216274 CCTGTGGGGGGTCAGTCTACTCC No data
Right 948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948765291 Original CRISPR ACCCAAGAAAAAGGGTACAT AGG Intergenic
No off target data available for this crispr