ID: 948765789

View in Genome Browser
Species Human (GRCh38)
Location 2:240217984-240218006
Sequence AGGCCCCTTCCAGGACCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948765775_948765789 30 Left 948765775 2:240217931-240217953 CCCCGTTGCTCACGGGGTCTCAG No data
Right 948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG No data
948765783_948765789 1 Left 948765783 2:240217960-240217982 CCTGTGAGGGGCTGTGCTGACCC No data
Right 948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG No data
948765777_948765789 28 Left 948765777 2:240217933-240217955 CCGTTGCTCACGGGGTCTCAGAT No data
Right 948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG No data
948765782_948765789 4 Left 948765782 2:240217957-240217979 CCACCTGTGAGGGGCTGTGCTGA No data
Right 948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG No data
948765781_948765789 5 Left 948765781 2:240217956-240217978 CCCACCTGTGAGGGGCTGTGCTG No data
Right 948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG No data
948765776_948765789 29 Left 948765776 2:240217932-240217954 CCCGTTGCTCACGGGGTCTCAGA No data
Right 948765789 2:240217984-240218006 AGGCCCCTTCCAGGACCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948765789 Original CRISPR AGGCCCCTTCCAGGACCCGC GGG Intergenic
No off target data available for this crispr