ID: 948766944

View in Genome Browser
Species Human (GRCh38)
Location 2:240227249-240227271
Sequence CAGGCTGCTGGGTAGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948766937_948766944 -6 Left 948766937 2:240227232-240227254 CCCTGAGGCCTCCAGTGCAGGCT No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data
948766930_948766944 15 Left 948766930 2:240227211-240227233 CCCTGAGTGATCACCTCCAGCCC No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data
948766936_948766944 -5 Left 948766936 2:240227231-240227253 CCCCTGAGGCCTCCAGTGCAGGC No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data
948766931_948766944 14 Left 948766931 2:240227212-240227234 CCTGAGTGATCACCTCCAGCCCC No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data
948766934_948766944 -1 Left 948766934 2:240227227-240227249 CCAGCCCCTGAGGCCTCCAGTGC No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data
948766933_948766944 2 Left 948766933 2:240227224-240227246 CCTCCAGCCCCTGAGGCCTCCAG No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data
948766938_948766944 -7 Left 948766938 2:240227233-240227255 CCTGAGGCCTCCAGTGCAGGCTG No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data
948766929_948766944 20 Left 948766929 2:240227206-240227228 CCTGGCCCTGAGTGATCACCTCC No data
Right 948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948766944 Original CRISPR CAGGCTGCTGGGTAGGAGTG AGG Intergenic
No off target data available for this crispr